The alpha-2 adrenergic receptor in the bovine pineal gland and the rodent homologues of the human alpha-2-C10 receptor express alpha-2D subtype pharmacological characteristics. The alpha-2 adrenergic receptor in the chicken pineal expresses characteristics similar to the alpha-2A subtype found in human and pig. The rodent receptors (alpha-2D) contain a serine residue at position 201 whereas the human and porcine receptors (alpha-2A) have a cysteine at this position. Our results indicate that the bovine pineal receptor has a serine at position 201, supporting the alpha-2D classification. Howeve
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Type VII collagen (C7) is a stratified squamous epithelial basement membrane protein composed of three identical alpha chains, each consisting of a 145-kDa amino-terminal noncollagenous (NC1) domain and a 145-kDa carboxyl-terminal collagenous domain. Morphologic and biochemical studies have shown that tissue-specific aggregates of C7 dimers called anchoring fibrils may contribute to epithelial basement membrane organization and adherence by interacting with extracellular matrix (ECM) proteins such as type IV collagen. In this study, we cloned a cDNA encoding most of the NC1 domain of C7. The d
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Types 1 and 3 fimbriae in Enterobacteriaceae play versatile roles in bacterial physiology including attachment, invasion, cell motility as well as with biofilm formation and urinary tract infections. Herein, we investigated the prevalence and transmission of plasmid-mediated types 1 and 3 fimbriae from 1753 non-duplicate Enterobacteriaceae from diseased food Animals. We identified 123 (7.01%) strong biofilm producers and all was identified as E. coli. WGS analysis of 43 selected strong biofilm producers revealed that they harbored multiple ARGs, including ESBLs, PMQR and mcr-1. The gene cluste
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Callosellasma rhodostoma (Malayan pitviper) is a monotypic Asian pitviper of medical importance. Three acidic phospholipases A2 (PLA2s) and one basic PLA2-homolog were purified from its venom while 10 cDNAs encoding distinct PLA2s were cloned from venom glands of a Thailand specimen of this species. Complete amino-acid sequences of the purified PLA2s were successfully deduced from their cDNA sequences. Among the six un-translated PLA2 cDNAs, two apparently result from recombination of its Lys49-PLA2 gene with its Asp49-PLA2 genes. The acidic PLA2s inhibit platelet-aggregation, while the noncat
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To isolate genes involved in tumor formation and in embryogenesis, a subtracted cDNA library was constructed from a c-myc-induced mouse brain tumor. A gene isolated in this screen, named TMP (tumor-associated membrane protein), codes for a putative glycoprotein with four transmembrane domains. The TMP gene was found to be highly expressed in brain tumor cells but not in normal brain. It is also expressed at high levels in undifferentiated embryonic stem cells, but markedly down-regulated in these cells after their differentiation into embryoid bodies. The TMP amino acid sequence bears high hom
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A genomic library of Bartonella bacilliformis was constructed and screened with human anti-Bartonella serum from a patient with the chronic, verruga peruana phase of bartonellosis. An immunoreactive clone isolated from this library was found to code for a 591-amino-acid protein with a high degree of sequence similarity to the FtsZ family of proteins. The degree of amino acid identity between the B. bacilliformis protein (FtsZ[Bb]) and the other FtsZ proteins is especially pronounced over the N-terminal 321 amino acids (N-terminal domain) of the sequence, with values ranging from 45% identity f
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In the great majority of patients with chronic myelogenous leukemia (CML) the reciprocal translocation between chromosomes 9 and 22, t(9;22)(q34;q11), resulting in the Philadelphia (Ph) chromosome produces fusion DNA sequences consisting of the 5' part of the major breakpoint cluster region-1 (M-BCR-1) and the ABL protooncogene which encodes for the P210BCR-ABL phosphoprotein with tyrosine kinase activity implicated in the pathogenesis of CML. Molecular analysis was performed on 25 patients with Ph-positive CML using 2 breakpoint cluster region (bcr) probes within the M-BCR-1 DNA sequences, an
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prot
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Streptococcus pneumoniae open reading frame SP0082 encodes a surface protein that contains four copies of a novel conserved repeat domain that bears no significant sequence similarity to proteins of known function. Homologous sequences from other streptococci contain two to six of these repeats, designated the SSURE (streptococcal surface repeat) domain. To investigate the functional role(s) of this domain, the third SSURE repeat of SP0082 sequence has been expressed in Escherichia coli, purified to homogeneity and characterized by biochemical and immunological methods. The expressed protein f
СтатьяПоддержка NIH: внешняя программаПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
cDNAs encoding the Mr 54,000 chicken cartilage matrix protein (CMP) were selected from a cartilage cDNA expression library by immunological means. Antibodies elicited against insert-encoded protein purified from one of the clones reacted specifically with chicken CMP in immunoblots of total cartilage extract, providing positive identification of the cDNA clones isolated. The cDNAs detect a 3.4-kilobase transcript that was present in sternal cartilage and in cartilaginous but not in precartilaginous embryonic limb tissues. The cDNAs code for 416 amino acids of the chicken CMP, including its COO
СтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Given the pervasiveness of gene sharing in evolution and the extent of homology across the tree of life, why is everything not homologous with everything else? The continuity and overlapping genetic contributions to diverse traits across lineages seem to imply that no discrete determination of homology is possible. Although some argue that the widespread overlap in parts and processes should be acknowledged as "partial" homology, this threatens a broad base of presumed comparative morphological knowledge accepted by most biologists. Following a long scientific tradition, we advocate a strategy
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
B-cell lymphoma 2 (Bcl-2) proteins are central, conserved regulators of apoptosis. Bcl-2 family function is regulated by binding interactions between the Bcl-2 homology 3 (BH3) motif in pro-apoptotic family members and the BH3 binding groove found in both the pro-apoptotic effector and anti-apoptotic Bcl-2 family members. A novel motif, the reverse BH3 (rBH3), has been shown to interact with the anti-apoptotic Bcl-2 homolog MCL1 (Myeloid cell leukemia 1) and have been identified in the p53 homolog p73, and the CDK4/6 (cyclin dependent kinase 4/6) inhibitor p18INK4c, (p18, cyclin-dependent kina
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prostaglandins derived from arachidonic acid are involved in a wide variety of physiological and pathological processes. The primary enzymes involved in the production of PGE2 from arachidonic acid are cyclooxygenases and prostaglandin E synthases. These enzymes have been identified in human, but only partially in the monkey where microsomal PGES-1 and cytosolic PGES have not been characterized. The present study was undertaken to clone these enzymes and to study their tissue distribution, along with mPGES-2. The coding sequence of Macaque mPGES-1 is 98% homologous to human mPGES-1 at the nucl
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We used polymerase chain reaction (PCR) to amplify a segment, about 560 base pairs (bp), of HIV-1 gag DNA prepared from peripheral blood mononuclear cells of a seropositive Taiwanese pair of mother and infant. TM-1 and TC-1 clones of PCR-amplified DNA derived from the mother and infant, respectively, showed a 94.5% homology with each other. However, the TM-1 and TC-1 sequences exhibited lower degrees of homology, i.e. only 85.1% and 85.8%, respectively, with the corresponding gag segment of a North American HIV-1 subtype (HXB2), and 86.4% and 87.0%, respectively, with that of a Zairean HIV-1 s
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To explore a possible recessive selective marker for future DNA-free genome editing by direct delivery of a CRISPR/Cas9-single guide RNA (sgRNA) ribonucleoprotein complex, we knocked out homologs of the Arabidopsis Multi-Antibiotic Resistance 1 (MAR1)/RTS3 gene, mutations of which confer aminoglycoside resistance, in tobacco plants by an efficient Agrobacterium-mediated gene transfer. A Cas9 gene was introduced into Nicotiana tabacum and Nicotiana sylvestris together with an sgRNA gene for one of three different target sequences designed to perfectly match sequences in both S- and T-genome cop
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Malaria is a disease annually causing over 400,000 deaths. Deep understanding of molecular and genetic processes underlying its life cycle and pathogenicity is required to efficiently resist it. RNA interference is a mechanism of the gene expression regulation typical for a wide variety of species. Even though the existence of this phenomenon in Plasmodium falciparum has long been rejected, several recent works pose hypotheses and provide direct and indirect evidence of the existence of mechanisms similar to RNA interference in this organism. In particular, the possibility of regul
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Salmonella enterica is a major foodborne pathogen causing symptomatic diseases or asymptomatic infections in humans. To reveal the genetic difference of Salmonella strains from patients to that from asymptomatic people, we used CRISPR typing to analyze the phylogenetic relationship of 180 clinical strains during 2017-2018 in Jiangsu, China. The CRISPR typing divided these isolates into 76 CRISPR types with a discriminatory power of 97.6%. S. Typhimurium and its monophasic variants of 6 CRISPR types are the significant serotypes causing both human diseases and asymptomatic infection, while S. E
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mutations in L1CAM are responsible for X-linked hydrocephalus, whereas those in the ALD gene (ABCD1) cause adrenoleukodystrophy. In both genes, most of the mutations reported so far are short-length mutations and only a few patients with larger rearrangements have been documented. We have characterized three intragenic deletions of the ALD gene at the molecular level and describe here the first two L1CAM rearrangements resulting in deletion of several exons in one case and about 50 kb, including the entire gene, in the second case. At both breakpoints of an ALD deletion, Alu repeats have been
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A deficiency of the enzyme iduronate-2-sulfatase (IDS) is the cause of Hunter syndrome (mucopolysaccharidosis type II). Here, we report a study of the human IDS locus at Xq28. An unexpected finding was an IDS-related region (IDS2) which is located on the telomeric side of the IDS gene within 80 kb. We have identified sequences in this locus that are homologous to exons 2 and 3 as well as sequences homologous to introns 2, 3 and 7 of the IDS gene. The exon 3 sequences in the IDS gene and in the IDS2 locus showed 100% identity. The overall identities of the other identified regions were 96%. A l
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The repetitive DNA sequences of the genome of Molluscum contagiosum virus type 1 (MCV-1) have been localized within the terminal regions of … I MCV-1 DNA fragment J1 between the nucleotide positions 2437 and 4107 (1670 bp). The degree of DNA sequence homology detected between the repetitive DNA sequences in the HindIII DNA fragments K and J1 of the viral genome was found to be 98%. The number of open reading frames (ORFs) detected by the analysis of the DNA sequences of the HindIII MCV-1 DNA fragments K …
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования