PURPOSE: We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation.
METHODS: We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, a…
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Although Helicobacter Pylori (HP) was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR). By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR.
METHODS: The samples were taken from 55 patients with benign laryngeal lesion…
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Universal primers and probes were selected on the basis of the 16S rRNA gene sequence of Borrelia burgdorferi in GenBank®, and a real-time polymerase chain reaction (PCR) method for detection of B. burgdorferi was established. The results showed that this method could specifically detect the B31 strain (Borrelia burgdorferi sensu stricto), the BO23 strain (Borrelia afzelii), and the SZ strain (Borrelia garinii), without cross-reaction with genome DNA of Theileria (T. luwenshuni, T. uilenbergi, T. sinensis, T. annulata, T. sergenti, T. annulata), Babesia (B. bigemina, B. ovate, B. sp. (Xinjiang…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of this study was to develop an immunocapture polymerase chain reaction (IC-PCR) protocol for leptospirosis. For the standardization of IC-PCR, polyclonal (AS) and monoclonal (MAb) antibodies against different serogroups and serovars of Leptospira were coupled to polystyrene plates. Human sera were artificially contaminated with leptospires and incubated on plates. The bacterial DNA was obtained and used in a multiplex PCR. Sensitivity was tested using sera contaminated with crescent concentrations of leptospires, while specificity was established using sera contaminated with different…
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A rapid and reliable triplex PCR procedure was developed to detect pathogenic fungi directly from specimens of onychomycosis. One hundred and four patients were included in this study. Of them, forty-five (43.3%) were finally diagnosed with onychomycosis according to the diagnostic criteria. The sensitivity of PCR, microscopy and culture were 93.3%, 100% and 64.4%, respectively; the specificities were 100%, 86.4% and 100%, respectively; the positive predictive values were 100%, 84.9% and 100%, respectively; the negative predictive values were 95.2%, 100% and 78.7%, respectively. This molecular
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: To determine the usefulness of real-time polymerase chain reaction (PCR) assays in the diagnosis of postoperative bacterial endophthalmitis in clinically diagnosed infectious cases and to test for bacterial DNA in control samples collected from noninfected eyes.
SETTING: Federal University of São Paulo, Brazil.
DESIGN: Evaluation of diagnostic test or technology.
METHODS: This study comprised patients with clinically diagnosed infectious endophthalmitis after cataract surgery and vitreous samples (from noninflamed eyes obtained through vitrectomy) and aqueous samples (at end of pha…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The human liver fluke, Opisthorchis viverrini, has been categorized as a class one carcinogenic organism according to its strong association with cholangiocarcinoma, bile duct cancer which has high incidence in the northeast of Thailand. The lack of genome database of this parasite limited the studies aimed to understand the basic molecular biology of this carcinogenic liver fluke. The determination of the genome size is an initial step prior to the full genome sequencing. In this study, we applied an absolute quantitative real-time polymerase chain reaction for this aspect. Our results indica…
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Brucellosis is a worldwide zoonosis leading to tremendous economic losses and severe human illness. Fast and reliable laboratory tests are needed to detect disease in both humans and animals and to monitor the production of safe food products and feed. For rapid identification of the genus Brucella and differentiation of its species, a multiplex polymerase chain reaction microarray assay based on 11 signature sequences and redundant oligonucleotide probes was developed. The gene targets included genus-specific sequences in bcsp31, perA, cgs, and omp2b, as well as chromosomal regions displaying…
Оценочное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Visceral leishmaniasis (VL) is caused by the protozoan parasite Leishmania donovani and is a potentially fatal disease in endemic areas of the world. Nepal is an endemic area in which VL causes major public health problems in the lowland areas of the southeast regions. The aim of the present study was to evaluate the sensitivity of polymerase chain reaction (PCR) amplification for the detection of Leishmania DNA from Giemsa's solution-stained bone marrow slides. Bone marrow samples were aspirated from a total of 115 VL suspected patients and used to prepare smears on glass slides and for the i…
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infecte … We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is …
Оценочное исследованиеПисьмо в редакциюПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Mutations in the PKHD1 gene are responsible for autosomal recessive polycystic kidney disease (ARPKD). Using exon scanning by … employing multiplex ligation-dependent probe amplification complemented with quantitative real-time polymerase chain reaction.
RESULTS: Sixteen ARPKD probands were studied in whom only one clearly pathogenic mutation was previously identified. One patient with a suspected homozygous deletion of the exons 1-37 was also included in this cohort. Three distinct PKHD1 germ-lin …
Оценочное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
CONTEXT: Reliable methods to screen newborns for congenital cytomegalovirus (CMV) infection are needed for identification of infants at increased risk of hearing loss. Since dried blood spots (DBS) are routinely collected for metabolic screening from all newborns in the United States, there has been interest in using DBS polymerase chain reaction (PCR)-based methods for newborn CMV screening.
OBJECTIVE: To determine the diagnostic accuracy of DBS real-time PCR assays for newborn CMV screening.
DESIGN, SETTING, AND PARTICIPANTS: Between March 2007 and May 2008, infants born at 7 US medical ce…
СтатьяПоддержка NIH: внешняя программаВалидационное исследованиеПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To establish a kind of simple method for identifying mumps virus gene: one-step reverse transcription-polymerase chain reaction, RT-PCR).
METHODS: To design primer in both sides of SH gene, and then to do the sensitivity and specificity test for the RT-PCR method.
RESULTS: At least 10(0.7) TCID50 mumps virus can be detected by this method. 5 strains of mumps virus can be detected and 4 strains of non-mumps virus including measles and rubella virus can't be detected by this method.
CONCLUSIONS: The one-step RT-PCR method is a rapid and simple method for identifying mumps virus gen…
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pasteurella multocida is the causative agent of fowl cholera in domesticated and wild birds. The disease outcome is affected by various host … rformed using the combination of nucleotide sequence analysis and a newly developed allele-specific polymerase chain reaction assay. Two major ptfA alleles were identified among 31 strains, representing various serogroups and somatic serotypes. It was noteworthy that allele specificity and case severity of a subset of strains correlated with the available gross pathology d …
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chlamydia trachomatis (CT) is the most prevalent sexually transmitted bacterial pathogen worldwide and causes severe reproductive tract infections. Currently, nucleic acid amplification tests (NAATs) are the gold standard for clinical diagnosis, but most NAATs are labor intensive and limited to specific CT serovars. We developed and validated a quantitative polymerase chain reaction (qPCR) assay that reproducibly detected CT serovars D, E, F, Ia, and Chlamydia muridarum over a linear range of 2 log(10) to 10 log(10) genomes with low coefficients of variation from both experimental and human ur…
Сравнительное исследованиеОценочное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The outlook for newly diagnosed patients with chronic myeloid leukemia (CML) in the imatinib era is excellent for most patients. However, im … bitor might be indicated. At least until complete molecular response is achieved, regular real-time polymerase chain reaction monitoring reinforces the fact that leukemia is still present and that compliance is a challenge that requires ongoing vigilance from the patient and the clinician.
СтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degr…
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования