CHARGE association is characterized by ocular Coloboma, Heart malformations, choanal Atresia, Retardation of growth and development, Genital abnormalities and inner and external Ear abnormalities. Growth failure is a frequent find mainly associated with feeding difficulties or systemic diseases. To date, GH deficiency has been reported in only few patients with CHARGE association however long-term effects of GH treatment, up to final height, have never been reported. We describe a patient with CHARGE association and GH deficiency treated with GH from the age of 3 years and 10 months up to adul
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The molecular identification and characterization of genetic defects leading to a number of rare inherited or acquired disorders affecting phosphate homeostasis has added tremendous detail to our understanding of the regulation of phosphate balance. The identification of the key phosphate-regulating hormone, fibroblast growth factor 23 (FGF23), as well as other molecules that control its production, such as the N-acetylgalactosaminyltransferase 3 GALNT3, the endopeptidase phosphate-regulating protein with homologies to endopeptidases on the X chromosome, and the matrix protein dentin matrix pr
СтатьяПоддержка NIH: внешняя программаОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Constitutional tall stature can be anticipated from neonatal length (1) and measurement at age 4 and 8 years (2). Mainly of genetic origin (3) it has been shown that tall children and parents have high normal or higher than normal serum hGH and/or IGF-I levels. (4-6). Also in a healthy adult population a significant (p<0.005) association between height and serum IGF-I has been reported (7). These within normal variations in "Работает" individuals should be distinguished from "gigantism" due to excessive GHR-H or hGH secretion (8, 9) and other pathological conditions leading to tall stature (3).
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During the past 20 years, growth hormone (GH) preparation has been applied for the treatment of short children with growth hormone deficiency (GHD) and its growth promoting effect has been well documented. GH with normal response to pharmacological stimulation tests, was found to be a treatable short stature. In these conditions GH therapy is acceptable on a basis of endocrine replacement therapy. Clinical trials of GH therapy revealed beneficial effects on final height in the patients with Turner syndrome, achondroplasia, and renal failure. The trial on constitutional or non-endocrine short s
Аннотация на английскомСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 14 year old patient had both Moebius anomalad with arthrogryposis and growth hormone deficiency due to a midline defect. This combination suggests an abnormality in the organization of the neural crest and homologous neural tube segment.
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We present an 18-year-old patient who has been on renal replacement therapy since the age of 11. He had growth retardation and delayed puberty, with a bone age of 13.6 years. Treatment with human recombinant growth hormone (rhGH) resulted in a clearcut increase in height and lean body mass. We emphasize that rhGH treatment could be tried even at a postpediatric age, provided bone radiology suggests that further growth is possible.
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Skeletal maturation is marked by an orderly and reproducible sequence of recognizable changes in the appearance of the skeleton during childhood. Such changes include the timing and sequence of the appearance of the centers of ossification, specific alterations in the contours of the bones, and the timing and sequence of the ultimate closure of the growth plates. Radiographically, skeletal maturity can be assessed by comparing the radiographic appearance of portions of an individual child's skeleton with the standardized appearance in a comparable population of children at various stages in th
СтатьяОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The molar ratio or two blood polyamines (spermidine to spermine) was investigated in 54 children with shortness of stature. The long-term reproducibility of this ratio was 9.0%. In children with no endocrine disturbances, the mean ratio was 0.97. In children with isolated growth hormone deficiency, it was 0.61, and in those with growth hormone and ACTH deficiency, it was 0.67, both significantly low values. The ratio showed a significant positive correlation with growth hormone response to insulin hypoglycemia (r = 0.58; P less than 0.001) and with the nitrogen retention response to short-term
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A patient with growth hormone deficiency and primary amenorrhoea became pregnant with the help of human menopausal gonadotrophin. Pregnancy was complicated only by abdominal discomfort due to her very small stature and by moderate oedema. She was delivered of healthy female twins by lower segment Caesarean section at the 37th week.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We studied endocrine function in three siblings with short stature and enlargement of the sella turcica. Sellar volumes were 5.9, 3.7 and 4.0 standard deviations above age-specific means. Computed tomography or pneumoencephalography showed full sellae without suprasellar extension. Basal thyrotropin levels were low despite hypothyroidism and increments were less than 3 micromicron per milliliter after thyrotropin-releasing hormone injection. Stimulated growth hormone levels were less than 5 ng per milliliter, declining to less than 2 ng per milliliter after thyroxine treatment. Both thyroxine
Клинический случайСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: It is unclear whether the blunted GH secretion in Prader-Willi Syndrome (PWS) is a true deficiency, or merely secondary to obesity. We have investigated the role of obesity in the blunted GH secretion in PWS.
DESIGN: We studied the GH response to a combined administration of GHRH (1 microgram/kg i.v. at 0 min) and pyridostigmine (PD) (60 and 120 mg by mouth for children and adults, respectively, at time -60 min), as well as the baseline IGF-I levels, in a group of patients with PWS. Two different control groups were studied with GHRH + PD using the same doses and methods as above:
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thirty-one patients with growth hormone insensitivity syndrome (GHIS) and 2 with GH gene deletion (age 11.2 (3.7-22.9) years; BA (GP) 8.2 years; height -6.5 +/- 1.6 SDS) were recruited for the multicenter study. At birth, length was more retarded (-1.38 SDS) than weight (-0.56 SDS). The rhIGF-I dose was 40-120 micrograms/kg BW twice daily s.c. In 26 patients, first year HV increased from 3.9 +/- 1.8 to 8.5 +/- 2.1 cm/year (delta (d) HT SDS 0.8 +/- 0.5). In 18 patients, second year HV was 6.4 +/- 2.2 cm/year (dHT SDS 0.4 +/- 0.5). There was normal progression of puberty. Mean progression of BA
Клиническое исследованиеСтатьяМногоцентровое исследованиеПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Growth hormone (GH) therapy is a cornerstone in managing pediatric growth disorders, yet individual responses vary significantly despite standardized protocols. This variability underscores the need for a comprehensive predictive framework to guide clinical decisions and optimize outcomes. Key determinants of growth response include the underlying diagnosis and degree of GH sensitivity, with conditions like severe GH deficiency typically responding better than disorders such as idiopathic short stature, small for gestational age, or Turner syndrome. Patient-specific factors - including age at …
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Posttraumatic elbow stiffness remains a common and challenging clinical problem. In the setting of a congruent articular surface, the joint capsule is regarded as the major motion-limiting anatomic structure. The affected joint capsule is characterized by irreversible biomechanical and biochemical fibrogenic changes strikingly similar to those observed in many other fibroproliferative human conditions. Studies in humans and preclinical animal models are providing emergent evidence that neuroinflammatory mechanisms are critical upstream events in the pathogenesis of posttraumatic connective tis
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of the research was to study tissue blood flow in the dynamics of malignant tumor growth (Ehrlich carcinoma of 80 mice, sarcoma--37-80 rats, 30 rabbit--Brown-Pirs carcinoma) in functionally different organs of experimental animals (mice, rats, rabbits): skeletal muscles, liver, ear, mammary gland and ciliary body of eye. The study was conducted using H clearance method. Deformability of erythrocytes was studied using filtration-photometry method. Blood surface tension was studied by Rebinder bubble maximal pressure method. Obtained data were analyzed by Student's t criterion. The inves
Аннотация на английскомСтатьяПолный текст не найденОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования