Some strains of Bacillus sphaericus are entomopathogenic to mosquito larvae, which transmit diseases, such as filariasis and malaria, affecting millions of people worldwide. This species is unable to use hexoses and pentoses as unique carbon sources, which was proposed to be due to the lack of glycolytic enzymes, such as 6-phosphofructokinase (PFK). In this study, PFK activity was detected and the pfk gene was cloned and sequenced. Furthermore, this gene was shown to be present in strains belonging to all the homology groups of this heterogeneous species, in which PFK activity was also detecte
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The rat homologue of the presenilin-1 (PS-1) gene, which is responsible for early-onset familial Alzheimer's disease linked to chromosome 14, was cloned and sequenced. The predicted amino acid sequence showed quite high homology among rat, mouse, and human PS-1. Especially, the amino acid sequences of the putative transmembrane domains were highly conserved among the three species. The expression ĺevel of the PS-1 gene increased during brain development and the number of transcripts of the PS-1 gene changed during brain development. We found one transcript of the PS-1 gene in embryonic day 12
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Protein and genomic studies of a previously uncharacterized porcine paramyxovirus (designated LPMV) confirmed that it was a member of the paramyxovirus genus. The nucleotide sequences and deduced amino acids of the complete P-gene, M-gene, F-gene and HN-gene as well as the intergenic sequences have been determined. Comparative sequence analysis of the M-gene of LPMV revealed the closest relationship of LPMV was to human mumps virus with a homology of 46% and 55% at the amino acid and nucleotide levels respectively. The P-gene of LPMV is transcribed to V protein mRNA and by editing of the gene
СтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Insight in the mechanisms of peptide hormone expression has grown explosively by elucidation of gene, mRNA and preprohormone structures for most hormone systems during the 1980s. The preprohormones vary considerably in size and organization from poly- to mono-protein structures. According to the structural organization and sequence homology the hormones are grouped in families. The prohormones are processed to bioactive peptides by multiple enzymatic modifications during the intracellular transport from the rough endoplasmatic reticulum to the mature secretory granules. The modifications compr…
СтатьяОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70%
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A synthetic fowl plague virus (FPV) haemagglutinin gene has been cloned in bacteria and the complete sequence of the RNA gene deduced. It is 1,742 nucleotides long and the mRNA codes for 56.3 amino acids in an uninterrupted sequence. The nature of some of the important domains in the haemagglutinin has been established, and their structure is discussed in relation to their function. Extensive amino acid sequence homologies exist between FPV and human influenza haemagglutinins.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Brevinase is a heterogeneous two-chain fibrinolytic enzyme, different from all of the known single-chain enzymes. A cDNA encoding brevinase was cloned from the venom gland of Agkistrodon blomhoffii brevicaudus by serial hybridization-PCR. Serial hybridization-PCR effectively amplified the complete cDNA of brevinase from the mixture of closely related transcripts. The cDNA sequence of 744 nucleotides was determined. The cDNA sequence included an open reading frame of 233 amino acids composed of an A chain (77 residues) and a B chain (156 residues). The deduced amino acid sequence included a pot
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The 5' region of the Japanese encephalitis virus (JEV) RNA was cloned and 3000 nucleotides (nt) were determined by sequencing DNA complementary to viral RNA, and genomic RNA, using oligodeoxynucleotide primers and the dideoxy chain-termination reaction. Comparison of the nt sequence and the reduced amino-acid sequence of JEV with those of other flaviviruses showed significant homologies, which allowed locations to be assigned for three structural proteins.
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Geographical variations of snake venoms of the same species are well-known. Exploring the components of venom from each region will give insights in its distinctive toxicities. Venom gland cDNA library of Russell's viper (RV) from Myanmar (Daboia russelii siamensis) was constructed to create a catalog of expressed sequences tags (ESTs) and to compare with sequences from RV of other countries. The cDNA library of venom gland was generated by using CloneMiner™ II cDNA Library Construction Kit. Clones were subjected to Sanger sequencing and analyses by bioinformatics tools. From 251 isolated clon
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A "long form" salivary thiol protease inhibitor, designated cystatin SA-I, was purified to homogeneity from human submandibular-sublingual saliva by sequential gel filtration and ion-exchange chromatography. Automated peptide sequencing data revealed that cystatin SA-I shares sequence homologies with salivary cystatin SN, except that it contains an additional octapeptide at its NH2 terminus. To further characterize the molecular basis of salivary cystatin diversity, a mixed-base oligonucleotide probe corresponding to a region within the NH2-terminal sequence of the salivary cystatins was synth
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Homology-based scaffolding orders contigs based on conserved collinearity of homologous sequences across related species. Existing methods often rely on costly whole-genome alignments or show limited robustness when integrating multiple references. Here, we introduce an anchor-based scaffolding framework that adapts synteny anchors to efficiently infer contig order and orientation relative to one or more reference genomes. Our approach leverages precomputed, sufficiently unique anchors and their respective high-confidence homology matches in a greedy approach, combining single-reference to mul
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements pres … led homologous recombination (HR). By contrast, non-homologous end joining (NHEJ) uses little-or-no sequence homology for exchange(10,11). The primary purpose of HR, in mitotic cells, is to repair double-strand breaks (DSBs) generated endogenously by aberrant DNA replication and oxidative lesions, or by exposure to ionizing radiation (IR), and other exogenous DNA d …
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We examined the expression of claudin-11 (CLDN11) in the testes and male reproductive tracts of rabbits. The rabbit CLDN11 cDNA sequences were nearly identical with human, mouse, and bovine CLDN11. The levels of CLDN11 mRNA and protein (22 kDa) were markedly increased in the testis during adult development. On postnatal day (PND) 10, CLDN11 was colocalized with ZO-1 at the lateral contacts between adjacent Sertoli cells and was perpendicular to the basal lamina. In adult testis on PND 180, CLDN11 was codistributed with ZO1, and the pattern of immunoreactivity consisted of wavy linear tracts pa
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A novel human leukocyte antigen (HLA)-B allele is described. The allele was identified in a German blood donor of Caucasian origin. Because high-resolution HLA-typing using sequence-specific primers gave inconclusive results, sequence-based typing was performed. Nucleotide sequences of exons 2 and 3 most closely match with HLA-B*4417 and HLA-B*440301 (99.5% identity). The predicted protein sequence revealed a single amino acid substitution (D156L) compared with the HLA-B*4417 allele but two substitutions (Y113H, D116S) compared with the HLA-B*440301 allele. Therefore, the novel allele has been
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have cloned and sequenced members of a cuticular protein multi-gene family from the mosquito Anopheles gambiae. Three genes (agcp2a-c), each approximately 1 kb in length, were found in a 17.4 kb genomic phage clone. Analysis of ten cDNAs revealed that at least four related genes are present. The open reading frame of the genes and cDNAs showed 95% sequence identity. Divergence was observed in the sequence of the 3' ends and the number of copies of two repeated coding sequences. In situ hybridizations with a probe prepared from one of these circular protein genes physically mapped to two loc
СтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tropical medicine and parasitology : official organ of Deutsche Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft fur Technische Zusammenarbeit (GTZ)1995eng
Chronic hyperactive dermatitis (sowda) in humans infected with the filarial parasite Onchocerca volvulus appears to reflect a hyperresponsiveness to parasite antigens. To identify antigens which play a role in this hyperresponsiveness an expression cDNA library of adult O. volvulus was screened with sera from patients with sowda. One further characterized cDNA clone, S1, consisting of 723 bp, surprisingly shows open reading frames (ORF) in both orientations. While a single ORF of 171 amino acids is present in sense orientation, a putative ORF of 95 AA is found in antisense orientation (aS1). W
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Adenovirus infections in humans are common and sometimes lethal. Adenovirus-derived vectors are also commonly chosen for gene therapy in human clinical trials. We have shown in previous work that homologous recombination between adenoviral genomes of human adenovirus species D (HAdV-D), the largest and fastest growing HAdV species, is responsible for the rapid evolution of this species. Because adenovirus infection initiates in mucosal epithelia, particularly at the gastrointestinal, respiratory, genitourinary, and ocular surfaces, we sought to determine a possible role for mucosal microbiota
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The nucleotide sequences of heavy and light chains from 10 monoclonal IgM anti-IgG1 (RF) antibodies were determined and reported here as tra … re structurally homogeneous. We aligned the VK sequences of the RF in hopes of finding some primary sequence homology between the represented VK families which might point to residues involved in the binding interaction. Although we found no such homology in the hypervariable regions, we did find significant and unexpected homology in the FR2 and FR3 of these light …
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding t
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Objective The objective of this in silico study was to compare nucleotide and amino acids DENV-2-NS1 sequences isolated from febrile patients, with and without disease severity, from different South American countries. Matherials and Methods A bayesian MCMC phylogenetic analysis was carried out using 28 complete sequences of the gene NS1 of the DENV-2 serotype (1 056 bp), using MrBayes v.3.2.0 software, with the model SYM+G (2.5 million generations). We also carried out a phylogenetic analysis with Neighbor-Joining method (Jukes-Cantor model). In addition, the amino acids sequences were aligne
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования