Background:Streptococcus pneumoniae colonize the human nasopharynx in the form of biofilms. The biofilms act as bacterial reservoirs and planktonic bacteria from these biofilms can migrate to other sterile anatomical sites to cause pneumonia, otitis media (OM), bacteremia and meningitis. Human amniotic membrane contains numerous growth factors and antimicrobial activity; however, these have not been studied in detail. In this study, we prepared amniotic membrane extract and chorionic membrane extract (AME/CME) and evaluated their antibacterial and antibiofilm activities against S. pneumoniae u
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Toxoplasma gondii is an obligate intracellular protozoan, causing the important zoonosis toxoplasmosis. This parasite utilizes a unique form of locomotion called gliding motility to find and invade host cells. The micronemal adhesin MIC2 plays critical roles in these processes by binding to substrates and host cell receptors using its extracellular adhesive domains. Although MIC2 is known to mediate important interactions between parasites and host cells during invasion, the specific host proteins interacting with MIC2 have not been clearly identified. In this study, we used a yeas
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND AND OBJECTIVE: Human ribonuclease inhibitor (hRI) extracted and purified from human placenta has been shown to remarkably inhibit some solid tumors in mice. This study was to construct V-pLNCX-s-hri, a secretory expression vector, and explore its inhibition effects on the growth of mouse B16 melanoma cells.
METHODS: The hRI gene sequence conjugated with the synthesized signal peptide of mouse IgG was cloned into the retroviral vector V-pLNCX to construct V-pLNCX-s-hri. The PA317 cells were used for viral package and NIH3T3 cells were employed to determine the viral titer. The expre
Аннотация на английскомСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Chronic hyperplastic eosinophilic sinusitis (CHS) results from the unregulated proliferation of eosinophils, T(H)2-like lymphocytes, goblet cells, mast cells, and fibroblasts and is present in most patients with asthma. The frequent coexpression of these disorders and their shared pathophysiology suggests that these are similar disorders affecting the upper and lower airways.
OBJECTIVE: We evaluated the expression of cysteinyl leukotrienes (CysLTs) in sinus tissue from subjects with CHS compared with that seen in healthy sinus tissue.
METHODS: Nasal polyp and sinus tissue was eva
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The present study investigated whether or not nitric oxide (NO) synthesis mediates mechanisms regulating activation of renin formation. Studies were performed on afferent arterioles freshly isolated from the rat kidney. We have shown previously that this preparation is a useful model to study regulation of renin synthesis and secretion. The expression of renin mRNA was assessed by ribonuclease protection assay, and total renin content and renin secretion by radioimmunoassay. In afferent arterioles isolated from rats treated with the angiotensin-converting enzyme inhibitor ramipril, renin mRNA
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The RNA genomes of 43 vesicular stomatitis virus (VSV) isolates of the New Jersey (NJ) serotype were T1-ribonuclease fingerprinted to compare the extent of genetic diversity of virus from regions of epizootic and enzootic disease activity. Forty of these viruses were obtained from Central America during 1982 to 1985. The other three were older isolates, including a 1970 isolate from Culex nigripalpus mosquitos in Guatemala, a 1960 bovine isolate from Panama, and a 1976 isolate from mosquitos (Mansonia indubitans) in Ecuador. The data indicate that extensive genetic diversity exists among virus
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: A previous investigation demonstrated that intravenous infusion of a saline-liver extract into rats causes acute renal failure (ARF), manifested by severe azotemia, extensive cast formation, and patchy tubular necrosis. The purpose of the present study was to explore its pathogenesis. Histologic assessments of rat kidneys made 1.5 hours after liver extract infusion demonstrated eosinophilic material within glomerular capillaries, Bowman's space, and proximal tubular lumina, distal nephron cast formation, and tubular dilation without evidence of tubular necrosis. Renal blood flow at
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A method is described for the isolation of lysosomal fractions from dark-grown potato shoots using a single stage separation on a Ficoll gradient. Peaks of acid hydrolase activity consisting of acid phosphatase, phosphodiesterase, ribonuclease, carboxylic esterase and β-glycerophosphatase were well separated from peaks of mitochondrial and glyoxysomal enzymes. A heavy lysosomal fraction with particle diameters from 0.1 to 1.6 μ and density of 1.10 g cm(-3) containing relatively low hydrolase activity was distinguishable from a light fraction with diameters 0.025 to 0.6 μ and density of 1.07 g
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A relatively sensitive and adequately reproducible assay of infectious enteroviral RNA was obtained by exposing calf serum-grown HeLa cells to RNA suspended in 2 M magnesium sulfate solution. Highly purified enteroviral preparations yielded RNA exhibiting more than 0.1 per cent of the infectivity of whole original virus and infectivity regressed linearly with dilution. Radioisotope experiments with P(32)-labeled RNA and spectrophotometric studies demonstrated that Gierer-Schramm phenol extraction permits almost quantitative recovery of high molecular weight RNA from poliovirus. Intact chromato
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prenatal air pollution exposure is linked to congenital heart defects (CHD), while the underlying molecular mechanisms remain poorly understood. Here we showed that maternal exposure to PM2.5, PM10, and NO2 was significantly associated with increased CHD risk during the periconception period, with NO2 exhibiting the strongest effect. Moreover, a supervised sparse partial least square model identified pollutant-specific protein signatures in both maternal serum and umbilical cord serum. These protein fingerprints could effectively reflect the levels of air pollution and were significantly assoc
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Plant RNA interference (RNAi) is a fundamental antiviral defense that relies on coordinated activities of DICER-like endonucleases (DCLs), Argonaute proteins (AGOs) and RNA-dependent RNA polymerases (RDRs). Over the past decades, studies using model and crop species have uncovered complex and often redundant roles for DCLs and RDRs in generating and amplifying virus-derived small interfering RNAs (vsiRNAs), in addition to connections with transcriptional gene silencing (TGS) and epigenetic defenses against DNA viruses. Concurrently, plant viruses have evolved diverse counterstrategies-proteina
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pleuropulmonary blastoma and hepatoblastoma are 2 well-recognized embryonal tumors of the thorax and liver respectively occurring in children. The simultaneous presentation of 2 or more pediatric embryonal tumors in the same patient is extremely rare. Specifically, cases of concomitant pleuropulmonary blastoma and hepatoblastoma in the same patient are extremely rare with only a single clinical case report published thus far. We report a case of a 25-month-old boy presenting with concomitant pleuropulmonary blastoma and hepatoblastoma, and describe the clinical, imaging, and histopathological
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DICER1-related tumors are characterized by germline loss-of-function mutations in one DICER1 allele (DICER1+/-) and a somatic "second hit" mutation in the remaining DICER1 allele. Whether the germline DICER1+/- mutation participates in tumorigenesis is unknown. We show that germline heterozygous loss of Dicer1 promotes tumor formation via aberrant neutrophil function in spontaneous and allograft mouse models of rhabdomyosarcoma. Germline heterozygous deletion of Dicer1 decreased tumor latency and increased tumor penetrance, while conditional heterozygous deletion in tumor cells did not, illust
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Pancreatitis is known to be an important risk factor for pancreatic ductal adenocarcinoma (PDAC). However, the exact molecular mechanisms of how inflammation promotes PDAC are still not fully understood. Regnase-1, an endoribonuclease, regulates immune responses by degrading mRNAs of inflammation-related genes. Herein, we investigated the role of Regnase-1 in PDAC.
METHODS: Clinical significance of intratumor Regnase-1 expression was evaluated by immunohistochemistry in 39 surgically-resected PDAC patients. The functional role of Regnase-1 was investigated by pancreas-specific Reg
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Embryonal rhabdomyosarcoma (ERMS) of the uterus has recently been shown to frequently harbor DICER1 mutations. Interestingly, only rare cases of extrauterine DICER1-associated ERMS, mostly located in the genitourinary tract, have been reported to date. Our goal was to study clinicopathologic and molecular profiles of DICER1-mutant (DICER1-mut) and DICER1-wild type (DICER1-wt) ERMS in a cohort of genitourinary tumors. We collected a cohort of 17 ERMS including nine uterine (four uterine corpus and five cervix), one vaginal, and seven urinary tract tumors. DNA sequencing revealed mutations of DI
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ribotoxins make up a group of extracellular rRNA endoribonucleases produced by ascomycetes that display cytotoxicity toward animal cells, having been proposed as insecticidal agents. Recently, the ribotoxin Ageritin has been isolated from the basidiomycetes Agrocybe aegerita (poplar mushroom), suggesting that ribotoxins are widely distributed among fungi. To gain insights into the protective properties of Ageritin against pathogens and its putative biotechnological applications, we have tested several biological activities of Ageritin, comparing them with those of the well-known ribotoxin α-sa…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 69-year-old Japanese woman presented with mild muscle weakness of the neck and symmetrical proximal parts of the upper and lower limbs. Laboratory tests, needle electromyography, and a muscle biopsy revealed inflammatory myopathy with an apparent clinical classification of polymyositis and positive findings for anti-PM/Scl-75 antibody. This antibody is rare among Japanese populations, and most Japanese patients with the antibody are not classified with the inflammatory myopathy seen in polymyositis. The muscle biopsy also showed marked necrotic and regenerative fibers. We need to collectivel
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Germ-line interstitial deletions involving the 14q32 chromosomal region, resulting in 14q32 deletion syndrome, are rare. DICER1 is a recently described cancer-predisposition gene located at 14q32.13. We report the case of a male child with a ∼5.8 Mbp 14q32.13q32.2 germ-line deletion, which included the full DICER1 locus. We reviewed available clinical and pathological material, and conducted genetic analyses. In addition to having congenital dysmorphic features, the child developed multiple DICER1 syndrome-related tumors before age 5 y: a pediatric cystic nephroma (pCN), a ciliary body medullo
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Impaired dendrite outgrowth of melanocytes is one of the reasons triggering vitiligo. RNASET2 was identified as one of the risk genes for vitiligo in a GWAS study conducted in the Chinese Han population. However, the role of Rnaset2 in the outgrowth of melanocytes is rarely studied.
OBJECTIVE: This study is to investigate the effects of Rnaset2 in regulating the outgrowth of melanocytes and its interacting proteins.
METHODS: Stress conditions (UV irradiation, hydrogen peroxide, and lipopolysaccharides) were applied to primary human epidermal melanocytes (HEMs) and epidermal kerat
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования