Infectious bronchitis virus (IBV) is a significant pathogen threatening global poultry production, known for its rapid transmission and the continuous emergence of new variants. Here, a monoclonal antibody (mAb) which specifically recognizes IBV SABD domain of S1 protein, designated 5G4, was prepared. This mAb, along with a previously developed mouse mAb (N1) targeting the IBV N protein, was utilized as the conjugate and capture antibodies, respectively, to develop a quantum dot-based lateral flow assay for the rapid detection of IBV infections. The optimal mass ratio of quantum dots to antibo
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aflatoxin B1 (AFB1) is a highly toxic and potent carcinogenic mycotoxin that poses a significant threat to food safety. Conventional immunochromatographic test strips (ICTS) often exhibit insufficient specificity and sensitivity. To address these limitations, a novel fluorescent ICTS (AQMs@G8-ICTS) was developed by integrating aggregated quantum microspheres (AQMs) with the high-affinity nanobody G8. Initially, the G8 nanobody was successfully expressed and purified, and its binding activity was validated using enzyme-linked immunosorbent assay (ELISA). The fluorescent signal probe was constru
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Since the outbreak of coronavirus disease 2019, the global demand for vaccines has increased rapidly to prevent infection and protect high-risk populations. However, identifying viral mutations poses an additional challenge for chromatographic purification of vaccines and subunit vaccines. In this study, a new affinity peptide model, X1VX2GLNX3WX4RYSK, was established, and a library of 612 peptides was generated for ligand screening. Based on a multistep strategy of ligand screening, 18 candidate peptides were obtained. The top ranking peptide, LP14 (YVYGLNIWLRYSK), and two other representativ
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Porcine epidemic diarrhea virus (PEDV) and rotavirus has posed a significant threat to the pig industry annually across different nations, resulting in huge economic losses. The frequent co-infection of these two viruses in clinical settings complicates the process of differential diagnoses. Rapid and accurate detection of PEDV and rotavirus is in great demand for timely diarrhea disease prevention and control. In this study, tris stabilized AuNPs were prepared and a sensitive lateral flow immunoassay (LFIA) sensor was developed for the simultaneous and rapid detection of PEDV and rotavirus on
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Yellow fever is endemic in Ghana and outbreaks occur periodically. The prodromal signs due to Yellow Fever Virus (YFV) infection are non-specific, making clinical signs unreliable as the sole criteria for diagnosis. Accurate laboratory confirmation of suspected yellow fever cases is therefore vital in surveillance programs. Reporting of ELISA IgM testing results by laboratories can delay due to late arrival of samples from the collection sites as well as limited availability of ELISA kits. In this study, the diagnostic performance characteristics of a rapid immunochromatographic Standard Q Yel
Оценочное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fascioliasis, a food- and water-borne trematodiasis, has been identified as a public health threat by the World Health Organization, with millions of people estimated to be infected or at risk of infection worldwide. We developed an immunochromatographic test (ICT) as a point-of-care (POC) tool for the rapid serodiagnosis of human fascioliasis caused by Fasciola gigantica and evaluated their diagnostic ability. Two tests were developed using antigens from adult F. gigantica excretory-secretory (ES) product and recombinant F. gigantica cathepsin L (rFgCL). Sera from 12 patients with parasitolog
Оценочное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Rabies kills approximately 59,000 people each year worldwide. Rapid and accurate diagnosis of rabies is important for instituting rapid containment measures and for advising the exposed people for postexposure treatment. The application of a rapid diagnostic tests in the field can greatly enhance disease surveillance and diagnostic activities, especially in resource poor settings. In this study, a total of 179 brain tissue samples collected from different rabies suspect animal species (113 dogs, 50 cattle, 10 cats, 3 goats, 2 horses, and 1 bear) were selected and tested using both
Оценочное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: The aim of this study was to isolate and characterise antifungal and bactericidal compounds from Bacillus amyloliquefaciens strain ELI149.
METHODS: An absorbent resin (Amberlite® XAD-16) and silica gel column chromatography were used for isolation and purification purposes, respectively. Antibacterial and antifungal assays were performed by the well diffusion method to demonstrate the biological activity of each compound. Cell damage of the tested fungi was evaluated for fengycin under phase-contrast microscopy. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Kudoa septempunctata, a myxosporean parasite of the olive flounder (Paralichthys olivaceus), causes foodborne gastroenteritis after ingestion of contaminated raw flounder. Available methods to detect K. septempunctata require expensive equipment, well-trained personnel, and lengthy procedures. Here we generated a novel monoclonal antibody (MAb 15G11) against K. septempunctata and used it to produce a prototype immunochromatographic assay (prototype Kudoa-ICA). Within 15min, the prototype Kudoa-ICA detected ≥1.0×105spores/mL in a spore suspension and ≥2.0×104spores/g of P. olivaceus muscle. The
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
CONTEXT: Adrenal vein sampling (AVS) is essential for identifying a surgically curable form of primary aldosteronism (PA), but accurate placement of the sampling catheter is technically challenging. Intraprocedural cortisol measurement can confirm the catheter's position, thereby increasing the AVS success rate.
OBJECTIVE AND METHODS: We developed a quick cortisol assay (QCA) that uses immunochromatography and gold nanoparticles and can be performed either semiquantitatively or quantitatively. The assay was evaluated in two studies. In a single-center study, PA patients were assigned to under
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of the study was to evaluate the usefulness of 3 chimeric Toxoplasma gondii antigens, P35-MAG1, MIC1-ROP1 and MAG1-ROP1, in the serodiagnosis of an acute toxoplasmosis in humans. Proteins were produced as fusion proteins containing His tags ends and then further purified by metal affinity chromatography. Their application for the diagnosis of recently acquired T. gondii infection was tested in IgG and IgM enzyme-linked immunosorbent assays (ELISAs). At 100%, 77.3%, and 86.4%, respectively, the reactivity of the IgG ELISA using P35-MAG1, MIC1-ROP1, and MAG1-ROP1 for sera from patients w
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Leptospirosis is a febrile worldwide zoonosis. Routine diagnosis of leptospiral infection is based on demonstration of specific antibodies with serological tests. Performance of the reference serological test, the microscopic agglutination test (MAT), requires significant expertise. The aim of our study was to find out if leptospiral infection can be proven with simple, rapid, commercially available immunochromatographic Leptocheck test in order to introduce it for the first level diagnosis in emergency cases with less specialized laboratory staff.
METHODS: In all, 590 serum sampl
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Gastrointestinal infection due to intestinal parasites is an enormous health problem in developing countries and its reliable diagnosis is demanding. Therefore, this study aimed at evaluating a commercially available immunochromatographic assay (ICA) for the detection of cryptosporidia, Giardia duodenalis, and Entamoeba histolytica/dispar for its usefulness in the Greater Cairo Region, Egypt. Stool samples of 104 patients who presented between October 2012 and March 2013 with gastrointestinal symptoms or for the exclusion of parasites at Kasr-Al-Ainy University Medical School were examined by
Оценочное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
It is critical to develop a cost-effective detection kit for rapid diagnosis and on-site detection of severe fever with thrombocytopenia syndrome virus (SFTSV) infection. Here, an immunochromatographic assay (ICA) to detect SFTSV infection is described. The ICA uses gold nanoparticles coated with recombinant SFTSV for the simultaneous detection of IgG and IgM antibodies to SFTSV. The ICA was developed and evaluated by using positive sera samples of SFTSV infection (n = 245) collected from the CDC of China. The reference laboratory diagnosis of SFTSV infection was based on the "gold standard".
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Typhoid fever is a severe systemic infection endemic in many developing countries, including Bangladesh. Present study evaluated immunochromatographic test (ICT) and Widal test in the early diagnosis of typhoid fever cases. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 200 individuals of different age and sex. Of them, 150 were clinically suspected cases of typhoid fever and 50 age-sex matched controls. Among 150 blood samples from the suspected cases 106(70.7%) were positive for IgM of Salmonell
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Using the principle of immunochromatography, we previously developed a method called RAPINA (Rapid Neutralizing Antibody detection test) that can measure the level of rabies virus -neutralizing antibody (VNA) in serum samples [Shiota S, Mannen K, Matsumoto T, Yamada K, Yasui T, Takayama K, et al. Development and evaluation of a rapid neutralizing antibody test for rabies. J Virol Methods 2009;161:58-62]. RAPINA is faster, simpler, and easier to perform compared with a virus-neutralizing test or enzyme-linked immunosorbent assay (ELISA). The improved version of RAPINA has greater positive and n
Сравнительное исследованиеОценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Composed of 35 amino acids, O3 is the smallest characterized protein encoded by vaccinia virus (VACV) and is an integral component of the entry-fusion complex (EFC). O3 is conserved with 100% identity in all orthopoxviruses except for monkeypox viruses, whose O3 homologs have 2 to 3 amino acid substitutions. Since O3 is part of the EFC, high conservation could suggest an immutable requirement for interaction with multiple proteins. Chordopoxviruses of other genera also encode small proteins with a characteristic predicted N-terminal α-helical hydrophobic domain followed by basic amino acids an
СтатьяResearch Support, N.I.H., IntramuralПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Acute symptoms of anisakidosis are caused by a type I allergic reaction in the gastrointestinal wall with elevated specific immunoglobulin (Ig)E. The purpose of this study was to investigate the presence of interleukin (IL)-4 in the larval antigens of Anisakis simplex. We detected concentrations of IL-4 in pg/ml when larval excretory--secretory products and crude extract from A. simplex were investigated by ELISA. Specific antibodies were obtained by immunization of rabbits with mouse IL-4 and tested in ELISA against A. simplex antigens obtaining higher values of optical density, that were con
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ornithine Transcarbamylase Deficiency, an X-linked disorder, is the most common cause of inherited urea cycle disorders. Approx. 90 mutations that produce reduced levels of ornithine transcarbamylase (OTCase) activity have been identified in patients [Tuchman (1993) Hum. Mutat. 2, 174-178; Tuchman and Plante (1995) Hum. Mutat. 5, 293-295]. A model of the three-dimensional structure of OTCase, developed on the basis of its homology to the catalytic subunit of Escherichia coli aspartate transcarbamylase (ATCase) [Tuchman, Morizono, Reish, Yuan and Allewell (1995) J. Med. Genet. 32, 680-688], and
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования