Loss of the short arm of chromosome 1 is frequently observed in many tumor types, including melanoma. We recently localized a third melanoma susceptibility locus to chromosome band 1p22. Critical recombinants in linked families localized the gene to a 15-Mb region between D1S430 and D1S2664. To map the locus more finely we have performed studies to assess allelic loss across the region in a panel of melanomas from 1p22-linked families, sporadic melanomas, and melanoma cell lines. Eighty percent of familial melanomas exhibited loss of heterozygosity (LOH) within the region, with a smallest regi
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have characterised a 2.4-Mb genomic sequence of a smallest region of overlap (SRO) deleted in the human microdeletion syndrome 7p21 by in silico analysis. Patients harbouring this minimal deletion present in addition to the clinical features of Saethre-Chotzen syndrome (MIM 101400) a distinct learning disability. This genomic region shows a very low gene content. Besides the transcription factor gene TWIST, the Histone Deacetylase 9 (HDAC9), Sorting Nexin 13 (SNX13) and an evolutionarily conserved bHLH transcription factor gene Nephew of Atonal 3 (HNATO3) have been detected previously. Here
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mechanisms of carcinogenesis through abnormalities of DNA repair genes are overviewed. Inactivation of DNA mismatch repair(MMR) gene(s) observed in tumors of hereditary non-polyposis colorectal cancer induces frameshift mutator mutation in MMR genes themselves, growth inhibitory genes and apoptosis inhibitory genes providing favorable genetic background for a malignant clone to be expanded. Deficiency of nucleotide excision repair that is usually employed for the removal of pyrimidine dimer formed by ultraviolet-irradiation in xeroderma pigmentosum (XP) causes hypersensitivity of the skin to s
Аннотация на английскомСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Multiple endocrine neoplasia type 1 (MEN 1) is characterised by the combination of tumours of the parathyroid, endocrine pancreas and anterior pituitary glands. In 1988 the MEN 1 gene was mapped to chromosome 11q13 and it was cloned in 1997. This gene contains 10 exons and extends across 9 Kb of genomic DNA; it encodes for a product of 610 amino acid named menin whose function is unknown. We have studied 10 unrelated MEN 1 kindreds by a complete sequencing analysis of the entire gene; mutations were identified in nine of them: five deletions, one insertion, two nonsense mutation and a complex
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The inherited mechanobullous disease, dystrophic epidermolysis bullosa, is caused by type VII collagen gene (COL7A1) mutations. We studied six unrelated patients with a distinct clinical subtype of this disease, epidermolysis bullosa pruriginosa, characterized by pruritus, excoriated prurigo nodules, and skin fragility. Mutation analysis using polymerase chain reaction amplification of genomic DNA, heteroduplex analysis and direct nucleotide sequencing demonstrated pathogenetic COL7A1 mutations in each case. Four patients had a glycine substitution mutation on one COL7A1 allele (G1791E, G2242R
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Linkage and haplotype analysis of eleven early-onset Alzheimer disease (AD) families was performed in relation to D21S210 and microsatellite DNA polymorphisms localized on chromosome 14q24.3. Linkage analysis of eight informative families out of eleven early-onset AD families disclosed the highest LOD score of 3.45 (theta = 0.00) at D14S77, while the locus of beta/A4 amyloid protein precursor gene was formally excluded within 10 cM from D21S210, given the evidence of recombinations in five families. Transmission disequilibrium study between the patients and controls without dementia indicated
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hermansky-Pudlak syndrome (HPS) is an autosomal recessive disorder that affects pigment production and platelet function and causes the deposition of a ceroid-like material in various tissues. Variability in the phenotype and the presence of several potential mouse models suggest that HPS may be a heterogeneous disorder. In order to identify a gene responsible for HPS, we collected blood samples from a relatively homogeneous population in Puerto Rico where the HPS carrier frequency is estimated to be 1 in 21. Analysis of pooled DNA samples allowed us to rapidly screen the genome for candidate
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Positional cloning is a powerful strategy for identifying the site of disease-producing mutations when the underlying biochemical defect is unknown. The approach also offers new methods for the presymptomatic diagnosis of genetic disease. Using these methods we have localized the PKD1 gene, mutated in the majority of PKD1 families, to a small (500 kb) segment of chromosome 16, band p13.3. Virtually all of this interval has been cloned in cosmids and lambda bacteriophage. Over 20 sets of non-overlapping cDNA clones have been isolated from the region. Sequence and mutational analyses are current
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Idiopathic torsion dystonia (ITD) is characterized by sustained, involuntary muscle contractions, frequently causing twisting and repetitive movements or abnormal postures. Most familial forms of ITD display autosomal dominant inheritance with reduced penetrance. Linkage analysis has been previously used to localize a dystonia gene to the 9q32-34 region in a large non-Jewish family and in a group of Ashkenazi Jewish families. Utilizing GT repeat polymorphisms from this region, here we demonstrate that the gene causing dystonia in Ashkenazi Jews can be localized to the 11-cM interval between AK
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This report describes a fluorescence in situ hybridization approach to chromosome staining that facilitates detection of structural aberrations and allows discrimination between dicentric chromosomes and symmetrically translocated chromosomes. In this approach, selected whole chromosomes are stained in one color by hybridization with composite probes whose elements have DNA sequence homology along the length of the target chromosomes. In addition, all chromosomes are counterstained with a DNA specific dye so that structural aberrations between target and non-target chromosomes are clearly visi
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A group of 46 European patients with mucopolysaccharidosis type I (MPS I) was screened for mutations of the alpha-L-iduronidase gene. The 2 common nonsense mutations, W402X and Q70X, were identified in, respectively, 37% and 35% of mutant alleles. Considerable differences were seen in the frequency of these 2 mutations in patients from North Europe (Norway and Finland) and other European countries (mainly The Netherlands and Germany). In Scandinavia, W402X and Q70X account for 17% and 62% of the MPS I alleles, respectively, while in other European countries W402X is about 2.5 times more freque
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The promoter of the human thymidine kinase gene was defined by DNA sequence and genetic analyses. Mutant plasmids with deletions extending into the promoter region from both the 5' and 3' directions were constructed. The mutants were tested in a gene transfer system for the ability to transform TK- cells to the TK+ phenotype. This analysis delimited the functional promoter to within an 83-base-pair region upstream of the mRNA cap site. This region contains sequences common to other eucaryotic promoters including G X C-rich hexanucleotides, a CAAT box, and an A X T-rich region. The CAAT box is
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70%
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
RNA was isolated from subribosomal particles of the malaria parasite Plasmodium knowlesi. The nucleotide composition (mole fraction) of the principal species was obtained (S-rRNA, 0.295A, 0.36U, 0.25G, 0.105C: L-rRNA, 0.326A, 0.31U, 0.228G, 0.144C). Ribosomal RNA was also isolated from Drosophila melanogaster. Optical properties of these A + U-rich species were measured. In all four cases analysis of the hypochromic effect revealed that adenine and uracil residues tended to form clusters along the polynucleotide chain. A substantial fraction of residues was located in bihelical regions of appr
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We analyzed the structure of the granulocyte colony-stimulating factor (G-CSF) receptor gene in a 6-year-old female patient with severe congenital neutropenia (SCN) who experienced severe recurrent infections since 1 month of age. There is no family history of any similar disease. When the patient was 4 months old, she began receiving treatment with recombinant human G-CSF that resulted in a small increase in the neutrophil count sufficient for the prevention and treatment of bacterial infection. An analysis of complementary DNA for the patient's G-CSF receptor revealed a 3-base pair deletion
Клинический случайИсторическая статьяСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dual-energy computed tomography (DECT) enables improved volumetric bone mineral density (vBMD) assessment by accounting for marrow alterations associated with aging, disease, and injury. However, DECT reconstruction kernels and monochromatic energy pair combinations may influence vBMD measurements and finite element model (FEM)-estimated bone stiffness. This study investigated the effects of reconstruction kernel and DECT energy pair combinations on proximal humeral vBMD and FEM-estimated stiffness in cadaveric specimens. Fourteen cadaveric shoulders from seven specimens were scanned bilateral
СтатьяСравнительное исследованиеПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The major clinical advantage of a phosphoric acid gel etchant is its superior control during placement. However, its viscosity can impede penetration into occlusal fissures, resulting in adequate etching and decreased pit-and-fissure sealant retention. This study examined the penetration of gel and liquid phosphoric acid etchants in occlusal fissures. The depth of fissure penetration of the acids was investigated using paired, sectioned samples and evaluated with a scanning electron microscope. The etch pattern was measured from the base of the fissure to the first demonstrable evidence of etc
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Metal-only Lewis pairs (MOLPs) based on zinc electrophiles are particularly interesting due to their relevance to Negishi cross-coupling reactions. Zinc-based ligands in bimetallic complexes also render unique reactivity to the transition metals at which they are bound. Here we explore the use of sterically hindered [Pt(P t Bu3)2] (1) to access Pt/Zn bimetallic complexes. Compounds [(P t Bu3)2Pt → Zn(C6F5)2] (2) and [Pt(ZnCp*)6] (3) (Cp* = pentamethylcyclopentadienyl) were isolated by reactions with Zn(C6F5)2 and [Zn2Cp*2], respectively. We also disclose the cooperative reactivity of 1/ZnX2 pa
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Approximately three quarters of acute hepatitis C (HCV) infections evolve to a chronic state, while one quarter are spontaneously cleared. Genetic predispositions strongly contribute to the development of chronicity. We have conducted a genome-wide association study to identify genomic variants underlying HCV spontaneous clearance using ImmunoChip in European and African ancestries. We confirmed two previously reported significant associations, in the IL28B/IFNL4 and the major histocompatibility complex (MHC) regions, with spontaneous clearance in the European population. We further fine-mappe
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования