Alzheimer's disease (AD) is a progressive neurodegenerative disease associated with aging, environmental, and genetic factors. Amyloid protein precursor (APP) is a known pathogenic gene for familial Alzheimer's disease (FAD), and now more than 70 APP mutations have been reported, but the genotype-phenotype correlation remains unclear. In this study, we collected clinical data from patients carrying APP mutations defined as pathogenic/likely pathogenic according to the American college of medical genetics and genomics (ACMG) guidelines. Then, we reanalyzed the clinical characteristics and ident
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To analyze the clinical features and genetic variant in a patient with Usher syndrome.
METHODS: Whole exome sequencing was carried out for the patient. Suspected variants were validated by Sanger sequencing of her parents and fetus.
RESULTS: The proband was found to harbor compound heterozygous variants c.17_18insA (p.Tyr6Ter*) and c.4095_4096insA (p.Arg1366Lys fs*38) of the PCDH15 gene (NM_033056), which were respectively inherited from her father and mother. The same variants were not detected in 100 healthy controls. Based on the guidelines of the American Society of Medical Ge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In recent years, a growing number of monogenic disorders have been described that are characterized by immune dysregulation. A subset of these "primary immune regulatory disorders" can cause severe interstitial lung disease, often recognized in late childhood or adolescence. Patients presenting to pulmonary clinic may have long and complex medical histories, but lack a unifying genetic diagnosis. It is crucial for pulmonologists to recognize features suggestive of multisystem immune dysregulation and to initiate genetic workup, since targeted therapies based on underlying genetics may halt or
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To analyze the clinical phenotype and genetic characteristics of a child with Perlman syndrome.
METHODS: Genomic DNA was extracted from peripheral blood samples from the patient and her parents. Whole exome sequencing (WES) was carried out to detect potential variant in the proband. Candidate variant was verified by Sanger sequencing. The pathogenicity of candidate variants was evaluated according to the guidelines of the American College of Medical Genetics and Genomics (ACMG).
RESULTS: The results of WES showed that the proband has harbored compound heterozygous variants of the
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for a child with mental retardation.
METHODS: The child was subjected to chromosomal microarray analysis (CMA) and targeted capture next-generation sequencing for the exons of genes related to genetic and metabolic diseases. Candidate variants were verified by Sanger sequencing of the child and his parents.
RESULTS: CMA suggested that the child has a 47,XYY karyotype. Next-generation sequencing revealed that the child has harbored compound heterozygous variants of the AUH gene, including c.677G>A (p.R226H) and c.373C>T (p.R125W), which were respectivel
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: By studying the odds of developing idiopathic subglottic stenosis in the isolated and genetically unique Hutterite population, this study sought to strengthen the hypothesis that an underlying genetic predisposition may exist for its development.
METHODS: A retrospective chart review examined the medical records of all adult patients treated for idiopathic subglottic stenosis in Saskatchewan between 2008 and 2018. Cases were segregated into Hutterite and non-Hutterite.
RESULTS: Four out of 36 cases of idiopathic subglottic stenosis occurred among Hutterites. The odds of a Hutteri
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To perform gene mutation analysis in a Chinese pedigree with dystrophic epidermolysis bullosa pruriginosa (DEB-Pr), and explore phetotype, genotype, and genotypes-phenotypes relationship of DEB-Pr.
METHODS: Potential variants of the COL7A1 gene were detected by skin targeted sequencing panel and verified by Sanger sequencing. The pathogenicity of the variation was analyzed.
RESULTS: Compound heterozygous variants, c.4128delT and c.8234G>A, were detected in the COL7A1 gene of the two patients. The c.4128delT(p.Pro1376fs) variant was derived from their mother and unreported previous
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for a Chinese pedigree affected with microphthalmia.
METHODS: Clinical data of the proband was collected. Whole exome sequencing (WES) was carried out to screen potential pathogenic variants in the proband. Candidate variant was verified by Sanger sequencing of the proband and his family members. Pathogenicity of the variant was predicted by searching the PubMed database and bioinformatic analysis. Sanger sequencing of amniotic fluid sample was carried out for prenatal diagnosis.
RESULTS: The proband and his father were found to harbor a heterozygous c
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic etiology for a patient featuring intellectual disability and torticollis.
METHODS: Peripheral blood sample was collected from the patient and subjected to G-banded karyotyping analysis and single nucleotide polymorphism array (SNP-array) assay.
RESULTS: The patient was found to have a chromosomal karyotype of 46,XX. SNP-array revealed that she has harbored a 3.8 Mb microdeletion at 10q26.3 which has encompassed 21 OMIM genes including EBF3 and ECHS1, and a 7.3 Mb duplication at 18q22.3q23 which has encompassed 19 OMIM genes including TSHZ1 and TXNL4A. Based
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for a patient with aortic root aneurysm and valve insufficiency.
METHODS: The patient was subjected to whole exome sequencing (WES) with a focus on the analysis of genes related to aortic aneurysm and other genetic diseases involving the cardiovascular system. Suspected pathogenic site was validated by Sanger sequencing of the patient and his family members.
RESULTS: WES has revealed a heterozygous c.830T>C variant (NM_001130916.3) in the patient, which was not detected among healthy members of his family. SIFT, PolyPhen2 and Mutation Taster predicted
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To detect variants of NF1 gene among thirteen patients with neurofibromatosis type 1.
METHODS: Genomic DNA was extracted from peripheral blood samples of the patients. High-throughput sequencing was employed to detect potential variants of the NF1 and NF2 genes.
RESULTS: Thirteen pathogenic variants were identified among the patients, which included one NF1 deletion, three missense variants, three nonsense variants and six frameshifting variants. Among these, 10 variants have been associated with neurofibromatosis type 1. c.4180A>T (p.Asn1394Tyr), c.4217dupT (p.Leu1406fs) and c.17
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Mucopolysaccharidosis type II (MPS II) is an X-linked multisystem disorder caused by mutations in the gene encoding iduronate 2-sulfatase (IDS). The clinical manifestations of MPS II include skeletal deformities, airway obstruction, cardiomyopathy, and neurologic deterioration. MPS II has high genetic heterogeneity disorder, and ~ 658 variants of IDS have been reported.
METHODS: We undertook a detailed pedigree analysis of four patients within the same family by targeted next-generation sequencing and Sanger sequencing.
RESULTS: We identified a novel heterozygous frameshift varia
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genetic variation in the highly conserved Sonic Hedgehog (SHH) gene is one of the most common genetic causes for the malformations of the brain and face in humans described as the holoprosencephaly clinical spectrum. However, only a minor fraction of known SHH variants have been experimentally proven to lead to abnormal function. Employing a phenotypic rescue assay with synthetic human messenger RNA variant constructs in shha-/- knockout zebrafish, we evaluated 104 clinically reported in-frame and missense SHH variants. Our data helped us to classify them into loss of function variants (31), h
СтатьяResearch Support, N.I.H., IntramuralПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Steel syndrome was initially described by H. H. Steel in 1993 in Puerto Rico, at which time he described the clinical findings required for diagnosis. The responsible gene, COL27A1, was identified in 2015 (Gonzaga-Jauregui et al., European Journal of Human Genetics, 2015;23:342-346). Eleven patients have previously been described with Steel syndrome and homozygous COL27A1 mutations, with eight having an apparent founder mutation, p.Gly697Arg. We describe three more patients identified at Einstein Medical Center Philadelphia and St. Christopher's Hospital for Children (Philadelphia, PA) diagnos
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Instituto Nacional de Neurología y Neurocirugía "Manuel Velasco Suárez" (INNN) is one of the main institutions in Latin America treating epilepsy; and bibliometric analysis has an increasing role in analyzing the literature, acting as a Google Maps of medical research. We tracked the scientific output in Scopus and the impact of the institution from its foundation to July 2020 in the field of epilepsy. We roughly separated this group by clinical and experimental approach, identifying core journals, type of article, increase with time, and number of citations. A total of 228 papers, from a
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE OF REVIEW: Patients with congenital heart disease (CHD) suffer from a pattern of neurodevelopmental abnormalities including deficits in language and executive function. In this review, we summarize recent studies that examine these outcomes, their risk factors, possible biomarkers, and attempts to develop therapeutic interventions.
RECENT FINDINGS: The latest literature has highlighted the role of genetics in determining neurologic prognosis, as we have increased our understanding of potentially modifiable perioperative risk factors. The role of potentially neurotoxic medical therapie
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To analyze the clinical presentation and gene of 2 pedigrees with suspected oculocutaneous albinism(OCA), and provide basis for clinical classification, genetic counseling and prenatal diagnosis.
METHODS: Variants were identified using next-generation sequencing(NGS) and confirmed by Sanger sequencing in 2 pedigrees with suspected OCA. The pathogenicity of the variants was analyzed according to the American College of Medical Genetics and Genomics (ACMG) standard.
RESULTS: Two compound heterozygous mutations of TYR and OCA2 genes were identified respectively in 2 pedigrees with su
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND AND OBJECTIVES: Hereditary hearing loss (HL) is known by a very high genetic heterogeneity, which makes a molecular diagnosis problematic. Next-generation sequencing (NGS) is a new strategy that can overcome this problem.
METHOD: A comprehensive family history was obtained, and clinical evaluations and pedigree analysis were performed in the family with 3 affected members. After excluding mutations in the GJB2 and 7 other most common autosomal recessive nonsyndromic HL genes via Sanger sequencing and genetic linkage analysis in the family, we applied the Otogenetics deafness NGS pa
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Tuberous Sclerosis Complex Autism Center of Excellence Network (TACERN) is a 6-site collaborative conducting longitudinal research on infants with tuberous sclerosis complex (TSC), focused on identifying early biomarkers for autism spectrum disorder (ASD). A multidisciplinary research team that includes the specialties of psychology, neurology, pediatrics, medical genetics, and speech-language pathology, its members work together to conduct studies on neurological status, brain structure and function, neurodevelopmental phenotype, and behavioral challenges in this population. This article
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования