The central nervous system (CNS) is highly susceptible to infections that can lead to severe neurological morbidity and mortality. Despite advances in diagnostic technologies, a significant proportion of encephalitis and meningitis cases remain etiologically undiagnosed, underscoring the need for novel pathogen discovery approaches. Here, we report the identification of a novel unclassified RNA virus, provisionally named hucaurvirus ("human CSF-associated unclassified RNA virus"), in the cerebrospinal fluid (CSF) of a pediatric patient with unexplained meningoencephalitis, using metagenomic ne
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Orf (contagious ecthyma) is a zoonotic infection caused by a dermatotropic parapoxvirus that commonly infects sheep, goats, and oxen. Parapoxviruses are transmitted to humans through contact with an infected animal or fomites. Orf virus infections can induce ulceration, and papulonodular, pustular, or ecthymic lesions of the skin after contact with an infected animal or contaminated fomite. Rarely, orf virus provokes extensive vasculo-endothelial proliferation as a skin manifestation. Here, we present the case of an 8-year old female with poxvirus-induced vascular angiogenesis that developed 1
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Orf-ecthyma contagiosum-is an endemic cutaneous disease caused by parapoxvirus that is transmitted via direct contact with contagious animals. The lesions are located frequently on the hands and fingers. Subungual presentation of orf is very rare. We report a case of solitary subungual orf. Suspicious subungual nodular lesions may be cases of orf, especially in endemic areas. Orf disease should be considered in the differential diagnosis of subungual nodular lesions to avoid unnecessary surgical interventions.
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A previously well male, 18 years of age, from a rural community, presented with three painful, itchy nodules on the fingers of his left hand, which had been present for 1 week. He had been prescribed amoxicillin clavulanate but presented again when there was no improvement after 4 days of taking antibiotics. Examination revealed three erythematous and umbilicated nodules without any halo, but with a central depression with exudate (Figure 1a). No specific treatment was instituted at this visit. One week later the patient re-presented with new erythematous lesions on the palms and
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We evaluated the temporal signal and substitution rate of tick-borne encephalitis virus (TBEV) using 276 complete open reading frame (ORF) sequences with known collection dates. According to a permutation test, the TBEV Siberian subtype (TBEV-S) data set has no temporal structure and cannot be applied for substitution rate estimation without other TBEV subtypes. The substitution rate obtained suggests that the common clade of TBEV (TBEV-common), including all TBEV subtypes and louping-ill virus (LIV), is characterized by the lowest rate (1.87 × 10-5 substitutions per site per year (s/s/y) or 1
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Orf is a disease of sheep due to a parapoxvirus. Transmission in man is possible, and is generally benign, self-limited condition. Although, rare complications have been mentioned. We report a case of Orf with erythema multiforme in a young girl.
CASE REPORT: A 13-year-old girl presented to our department with an erythema multiform. The cutaneous examination revealed painless erythematous nodule of her right index finger developed 15 days after a contact with a lamb. The diagnosis of Orf complicated by erythema multiforme was made on the basis of her typical history. Lesions heal
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Background: Orf is a highly contagious zoonosis caused by Orf virus (ORFV), which is endemic in sheep and goats worldwide. Human Orf is usually a self-limiting disease, but potential complications, including immune-mediated reactions, may occur. Methods: We included all articles regarding Orf-associated immunological complications published in peer-reviewed medical journals. We conducted a literature search of the United States National Library of Medicine, PubMed, MEDLINE, PubMed Central, PMC, and the Cochrane Controlled Trials. Results: A total of 16 articles and 44 patients were included, p
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
tat, an essential gene of human immunodeficiency virus, when placed under the control of the RNA polymerase III promoter from the adenovirus VA RNA1 gene, is transcribed into an uncapped and nonpolyadenylated mRNA. This VA-Tat RNA is translated to produce functional Tat protein in transfected mammalian cells (Gunnery, S., and Mathews, M. B. (1995) Mol. Cell. Biol. 15, 3597-3607). The presence of an upstream open reading frame (ORF) in VA-Tat RNA is inhibitory to the translation of the Tat ORF, suggesting that the RNA is scanned during translation even though it is uncapped. Because the effect
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The complete nucleotide sequence of the Japanese encephalitis virus (JEV) genome RNA was determined. The JEV genome contains 10,976 nucleotides and encodes a single long open reading frame (ORF) of 10,296 nucleotides corresponding to 3432 amino acid residues. This long polypeptide is thought to be cleaved into three structural proteins and several nonstructural proteins of the virus. The genetic location of the three structural proteins was determined by comparing the deduced amino acid sequence from the nucleotide sequence with the N-terminal amino acid sequences that were determined from the
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In order to elucidate the mechanisms of hepadnavirus evolution in vivo and to trace the fate of known quasispecies in a single animal during the acute phase of infection, a woodchuck (Marmota monax) was infected with the hepadnavirus woodchuck hepatitis B virus (WHV). Woodchuck 197 (W197) was injected intravenously with pooled sera collected from a chronic carrier that had been infected originally with a molecular clone of known genome sequence (WHV7). Viral genome variants from both the inoculum and the follow-up sera from W197 were characterized for the presence of quasispecies related to th
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During investigations into the outbreak of duck viral infection in 2010 in China, with a severe drop in egg production, a flavivirus was isolated from the affected ducks. It was characterized as a Tembusu virus (TMUV). In this study, we obtained a complete genome sequence of Tembusu virus using RT-PCR and RACE techniques. TMUV genome is a singled-stranded RNA, with 10,990 nucleotides in length, and contains a single open reading frame (3410 amino acids) encoding 11 viral proteins with 5'and 3'non-translated regions (NTRs) of 142 and 618 nt, respectively. We characterized the open reading frame
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Many complications have been reported after orf infection, including lymphadenopathy, secondary bacterial infection, and erythema multiforme. Rare associations with papulovesicular eruptions, including a bullous pemphigoid-like eruption, have also been described.
OBJECTIVES: Our purpose was to clinically, histologically, and immunologically characterize two cases of orf-induced blistering disease, and to determine whether this condition represented a novel disease entity distinct from known immunobullous diseases.
METHODS: Two patients were clinically described and skin biopsy sp
Клинический случайСтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human orf is usually considered a rare disease caused by a virus belonging to the paravaccinia subgroup of pox viruses and transmitted to man from sheep and goats. This paper presents 119 new human cases with epidemiological, clinical, histopathological and ultrastructural findings. Erythema multiforme was found to be a common complication of human orf. Other complications tended to be caused by overtreatment. Electron microscopy of negatively stained suspensions from lesions was found to be the best and most rapid diagnostic method available.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human papillomavirus 6a (HPV6a), the most abundant HPV6 subtype, was detected in a vulvar condyloma acuminatum. The complete genome of HPV6a was cloned, and its DNA sequence was shown to be over 97% identical to the HPV6b sequence. Of the eight open reading frames (ORFs) of HPV6a, only the imputed amino acid sequence of the major capsid protein L1 was identical to the corresponding HPV6b sequence; all other HPV6a ORFs showed amino acid changes compared to the HPV6b ORFs. The HPV6a L1 or the L1 + L2 ORFs were expressed in the yeast Saccharomyces cerevisiae. Self-assembly of the L1 capsid protei
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human Immunodeficiency Virus Type 1 (HIV-1), the causative agent of the acquired immune deficiency syndrome (AIDS), originated from zoonotic transmissions of simian immunodeficiency viruses (SIVs) infecting African great apes, following complex cross-species transmission events and virus-host co-evolution. These processes were accompanied by multiple viral adaptations, particularly within structural and accessory genes, enabling evasion of host restriction factors and long-term viral persistence. In 1988, an antisense open reading frame (ORF) overlapping the env gene was proposed and subsequen
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Comparative analysis of amino acid and nucleotides sequences of ORFs located in extended segments of the terminal variable regions in variola virus genome detected a promising locus for viral genotyping according to the geographic origin. This is ORF O1L of VARV. The primers were calculated for synthesis of this ORF fragment by PCR, which makes it possible to distinguish South America-Western Africa genotype from other VARV strains. Subsequent RFLP analysis reliably differentiated Asian strains from African strains (except Western Africa isolates). This method has been tested using 16 VARV str
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The multi-country mpox outbreak across the globe has led to the systematic surveillance of mpox cases in India. During the surveillance of mpox, we encountered cases of Varicella Zoster Virus (VZV) in suspected mpox cases amongst children & adults. This study focused on the genomic characterization of VZV in India.
METHODS: A total of 331 mpox suspected cases were tested for VZV through real-time PCR, and the positive samples were subjected to next-generation sequencing to retrieve the whole genome of VZV using CLC genomics software. Phylogenetic analysis has been done in MEGA 11.
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The genome of the virus that causes salivary gland hypertrophy in Musca domestica (MdSGHV) was sequenced. This non-classified, enveloped, double stranded, circular DNA virus had a 124,279bp genome. The G + C content was 43.5% with 108 putative methionine-initiated open reading frames (ORFs). Thirty ORFs had homology to database proteins: eleven to proteins coded by both baculoviruses and nudiviruses (p74, pif-1, pif-2, pif-3, odv-e66, rr1, rr2, iap, dUTPase, MMP, and Ac81-like), seven to nudiviruses (mcp, dhfr, ts, tk and three unknown proteins), one to baculovirus (Ac150-like), one to herpesv
СтатьяПоддержка NIH: внешняя программаПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bovine enteric caliciviruses (BEC) are associated with diarrhea in young calves. The BEC strains detected in Europe form a third genogroup within the genus "Norwalk-like viruses" (NLV) of the family Caliciviridae. In this report, we present sequence, clinical, and histological data characterizing a novel enteropathogenic BEC strain, NB, detected in fecal specimens from calves in the United States. The complete RNA genome of the NB virus is 7,453 bases long and is organized into two open reading frames (ORFs). ORF-1 is 2,210 amino acids long and encodes a large nonstructural polyprotein contigu
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования