Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
25812 публикаций
Поиск: 285 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 3725 с найденным полным текстом
Oxytocin (OT) levels in plasma increase during sexual response and are significantly lower in patients with depression. A drug for the treatment of sexual dysfunction, sildenafil, enhances the electrically evoked release of OT from the posterior pituitary. In this study, we showed that sildenafil had an antidepressant-like effect through activation of an OT signaling pathway. Application of sildenafil reduced depression-related behavior in male mice. The antidepressant-like effect was blocked by an OT receptor (OTR) antagonist and was absent in OTR knockout (KO) mice. Sildenafil increased the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Chronic stimulation of the beta(1)-adrenoceptor (beta(1)AR) plays a crucial role in the pathogenesis of heart failure; however, underlying mechanisms remain to be elucidated. The regulation by transcription factors cAMP response element-binding protein (CREB) and cyclic AMP response element modulator (CREM) represents a fundamental mechanism of cyclic AMP-dependent gene control possibly implicated in beta(1)AR-mediated cardiac deterioration.
METHODS AND RESULTS: We studied the role of CREM in beta(1)AR-mediated cardiac effects, comparing transgenic mice with heart-directed express
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mutations in the genes encoding presenilins (PS1 and PS2) account for the majority of cases of early-onset Alzheimer's disease. PS1 and PS2 form the catalytic center of gamma-secretase, an enzyme responsible for intramembraneous proteolysis of several type I transmembrane proteins. Many gamma-secretase substrates are coupled to intracellular signaling events such as cAMP-response element binding protein and Rac1/p21-activated kinase pathways, which are associated with synaptic function. Here, we have examined the activation of these pathways in neurons lacking PS1 expression or gamma-secretase
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tests for skin sensitization are required prior to the market launch of new cosmetic ingredients and in vitro tests are needed to replace the current animal tests. Protein reactivity is the common feature of skin sensitizers and it is a crucial question whether a cellular in vitro assay can detect protein reactivity of diverse test chemicals. The signaling pathway involving the repressor protein Keap1 and the transcription factor nuclear factor-erythroid 2-related factor 2, which binds to the antioxidant response element (ARE) in the promoter of many phase II detoxification genes, is a potenti
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: To compare the in vitro functional activity of the prostate-specific antigen (PSA) androgen response element (ARE) I alleles alone or in combination with androgen receptor (AR) polymorphisms and to determine the association of ARE I alleles with serum PSA in men without clinical prostatic disease. Data are conflicting regarding the association of PSA promoter alleles with serum PSA in men.
METHODS: In vitro functional analyses of ARE I and AR polymorphisms were conducted by luciferase reporter assays in LNCaP and PC-3 cells. Associations among serum PSA, ARE I, and AR genotypes we
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fear of postoperative pain is a disincentive to living donor kidney transplantation. Laparoscopic donor nephrectomy (LDN) was developed in part to dispel this disincentive. The dramatic increase in the number of laparoscopic donor nephrectomies performed at our institution has been in part due to the reduction in postoperative pain as compared to traditional, open donor nephrectomy. We sought to further diminish the pain associated with this surgical technique. The purpose of this study was to compare the efficacy of three different postoperative pain management regimens after LDN. All living
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Resistance to radiation leukemia virus (RadLV)-induced leukemia is correlated with an increase in H-2Dd expression on the thymocyte surface. It has been shown that elevated H-2Dd expression on infected thymocytes is a result of elevated mRNA transcription and that the transcriptional increase is correlated with elevated levels of a DNA binding activity, H-2 binding factor 1 (H-2 BF1), which recognizes the 5'-flanking sequence (5'-TGACGCG-3') of the H-2Dd gene. Recently, it has been shown that the activation transcription factor 1 (ATF-1) homodimer is one form of the H-2 BF1 complex. Here we de
СтатьяПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cyclic AMP response element-binding protein (CREB) is a 43-kDa polypeptide that binds a cAMP response element located at the 5' promoter region of cAMP regulatory genes. The spatial and temporal distribution of CREB in the postnatal development of the rat submandibular gland was investigated using immunohistochemistry with a specific antibody. At birth, cells of the terminal tubules and ducts in the submandibular gland showed a nuclear CREB immunoreactivity of moderate intensity. At 1-2 weeks after birth, an intense CREB immunoreactivity was localized primarily to acinar cells. When the beta-a
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Previously, an androgen responsive element (ARE or promoter ARE) was identified in the proximal promoter region of the prostate-specific antigen (PSA) gene. The proximal promoter fragment could mediate androgen induction of expression of a heterologous reporter gene in androgen receptor (AR)-less cells with exogenous AR in co-transfection assays. However, it exerted little androgen inducibility in androgen sensitive human prostate cells, LNCaP, which produce PSA mRNA and protein. In this study, we have identified a second functional ARE (or upstream ARE) approximately 4 kb upstream of the cap
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this report, we describe the isolation and initial characterization of a Drosophila protein, dCREB-A, that can bind the somatostatin cyclic AMP (cAMP)-responsive element and is capable of activating transcription in cell culture. Sequence analysis demonstrates that this protein is a member of the leucine zipper family of transcription factors. dCREB-A is unusual in that it contains six hydrophobic residue iterations in the zipper domain rather than the four or five commonly found in this group of proteins. The DNA-binding domain is more closely related to mammalian CREB than to the AP-1 fac
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Three missense mutations in exon 17 of the beta-amyloid precursor protein (APP) gene have been reported to cosegregate in families with early onset Alzheimer's disease (AD). All three mutations result in amino acid substitutions at codon 717 and may produce AD by altering the structure of the transmembrane domain of APP. Alternatively, the mutations may destabilize the stem of a putative iron-responsive element (IRE) in which they lie and confer pathogenicity by inactivating this negative regulatory element. We have detected a clinically-silent mutation in codon 716 that would also be expected
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Resistance of Escherichia coli strain HB251 to the newer beta-lactam antibiotics, in particular ceftazidime and aztreonam, results from production of the extended-spectrum beta-lactamase TEM-6. The corresponding structural gene, bla(T)-6, and its promoter region were amplified by the polymerase chain reaction. Analysis of the sequence of the amplification product showed that bla(T)-6 differed by two nucleotide substitutions from bla(T)-1, the gene encoding TEM-1 penicillinase in plasmid pBR322. The mutations led to the substitution of a lysine for a glutamic acid at position 102 and of a histi
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Selenium (Se) is an essential trace element and its deficiency in utero may affect fetus development and birth outcomes. The current study aimed to assess serum Se status at delivery and examine the possible association between Se levels and birth outcomes. The interaction of Se with selected essential and toxic elements as well as possible sex-dependent responses in utero were also evaluated. The negative association between Se levels and head circumference of neonates was evident in the total cohort (β = -0.164; p < 0.001) as well as in the pre-term and full-term cohorts. Significant positiv
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Protein limitation in vivo or amino acid deprivation of cells in culture causes a signal transduction cascade consisting of activation of the kinase GCN2 (general control nonderepressible 2), phosphorylation of eukaryotic initiation factor 2, and increased synthesis of activating transcription factor (ATF) 4 by a translational control mechanism. In a self-limiting transcriptional program, ATF4 transiently activates a wide range of downstream target genes involved in transport, cellular metabolism, and other cell functions. Simultaneous activation of other signal transduction pathways by amino
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Post-traumatic stress disorder (PTSD) is an important psychological disease that can develop following the physical experience or witnessing of traumatic events. The psychopathological response to traumatic stressors increases inflammation in the hippocampus and induces memory deficits. Melatonin (MTG) plays critical roles in circadian rhythm disorders, Alzheimer's disease, and other neurological disorders. However, the cognitive efficiency of MTG and its mechanisms of action in the treatment of PTSD remain unclear. Thus, the present study investigated the effects of MTG on spatial
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The precise regulation of the iron-regulatory hormone hepcidin is essential to maintain body iron homeostasis: Hepcidin deficiency induces iron overload, and hepcidin excess results in anaemia. Mutations in the gene HFE2 cause severe iron overload and are associated with low hepcidin expression. Recent data suggest that HFE2 is a bone morphogenetic protein (BMP) co-receptor, and that the decreased hepcidin mRNA expression because of HFE2 dysfunction is a result of impaired BMP signalling ability. In this study, we identify a critical BMP-responsive element (BMP-RE) at position -84/-79 of the h
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
With recently legislated maximum levels of inorganic arsenic (iAs) in white and brown rice in Canada, the regulatory bodies are evaluating the need for regulation of As levels in infant food products. Rice is a major part of infants' diet, and therefore, the presence of As in this staple food causes concerns. So far, the scientific community was lacking suitable certified reference material (CRM) which could be used to assess the accuracy of developed analytical methods for As speciation in infants' food products. As a result, we have developed BARI-1, a baby cereal coarse rice flour reference
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MicroRNAs (miRNAs) are critical post-transcriptional regulators in many biological processes. They act by guiding RNA-induced silencing complexes to miRNA response elements (MREs) in target mRNAs, inducing translational inhibition and/or mRNA degradation. Functional MREs are expected to predominantly occur in the 3' untranslated region and involve perfect base-pairing of the miRNA seed. Here, we generate a high-resolution map of miR-181a/b-1 (miR-181) MREs to define the targeting rules of miR-181 in developing murine T cells. By combining a multi-omics approach with computational high-resoluti
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Wolffia globosa (watermeal) is a potential plant-based food ingredient. This study characterized its nutritional and physicochemical properties, elemental levels, total phenolic content (TPC), total flavonoid content (TFC), DPPH radical-scavenging activity, IL-6 production in H2O2-stimulated RAW264.7 macrophages, and preliminary cell-viability responses. On a dry-weight basis, the tested W. globosa sample contained 25.83% protein, 4.56% fat, 16.58% ash, 8.80% crude fiber, and 44.22% carbohydrate. Arsenic and zinc were detected below their limits of quantification, whereas cadmium, copper, and
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.