BACKGROUND: The respiratory pathogen Bordetella parapertussis is a valuable model in which to study the complex phenotype of host specificity because of its unique two-species host range. One subset of strains, including the sequenced representative, causes whooping cough in humans, while other strains infect only sheep. The disease process in sheep is not well understood, nor are the genetic and transcriptional differences that might provide the basis for host specificity among ovine and human strains.
RESULTS: We found 40 previously unknown genomic regions in an ovine strain of B. parapertu
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bacteria resembling two Bordetella species were isolated from both normal and pneumonic ovine lungs using a selective charcoal agar. Twenty-eight of the 33 isolates showed similarities to stock NCTC B. parapertussis strains in their SDS-PAGE gel protein profiles, in their biochemical reactions and in causing browning on tyrosine agar. Five isolates behaved similarly to stock B. bronchiseptica strains, in being actively motile, in giving identical positive reactions in three out of four biochemical tests and in causing no colour change in tyrosine agar. Multilocus enzyme electrophoresis separat
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Serotype-specific fimbriae of Bordetella pertussis are considered potential components of new-generation vaccines against whooping cough. Attempts to characterize fimbriae, and indeed other virulence determinants, produced by B. pertussis have been frustrated on one hand by low yields from B. pertussis itself and on the other by an inability to produce native recombinant products in Escherichia coli. In order to try to circumvent this problem, we have examined the expression of B. pertussis serotype 2 fimbriae in Bordetella parapertussis and Bordetella bronchiseptica from native as well as E.
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Pertussis is a highly contagious respiratory illness mainly caused by Bordetella pertussis (BP). Bordetella parapertussis (BPP) can induce symptoms compatible with pertussis, but has been underdiagnosed and underreported. The current pertussis vaccines offer low protection against BPP. Herein, we aim to reveal the epidemiology and genomic evolution of BPP in Shanghai, China.
METHODS: Children diagnosed with BPP infection from January 2017 to December 2022 in Shanghai, China were enrolled. We performed antimicrobial susceptibility testing (AST), multiple locus variable-number tande
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite excellent vaccine coverage in developed countries, whooping cough is a reemerging disease that can be caused by two closely related pathogens, Bordetella pertussis and B. parapertussis. The two are antigenically distinct, and current vaccines, containing only B. pertussis-derived antigens, confer efficient protection against B. pertussis but not against B. parapertussis. B. pertussis does not express the O antigen, while B. parapertussis retains it as a dominant surface antigen. Since the O antigen is a protective antigen for many pathogenic bacteria, we examined whether this factor is
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We analyzed the Bordetella pertussis and Bordetella parapertussis isolates circulating in Saint Petersburg that were collected between 1998 and 2000 and compared them with isolates collected 40 years ago and Russian vaccine strains. The analysis involved serotyping, pulsed-field gel electrophoresis of chromosomal DNA after digestion with XbaI and SpeI, and sequencing of the ptxS1 and prn genes, which encode the S1 subunit of the pertussis toxin and the major adhesin pertactin, respectively. The Russian isolates were classified in five of the six pulsed-field gel electrophoresis groups identifi
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Due to local and systemic side-effects, the currently used, highly effective, whole-cell pertussis vaccines (WCVs) will be replaced by acellular vaccines (ACVs) in some countries. These ACVs contain detoxified pertussis toxin, either alone or in combination with the filamentous haemagglutinin, pertactin and fimbriae. Ongoing clinical trials show that ACVs are clearly less reactogenic than WCVs and that ACVs comprised of three to five proteins are highly efficacious in inducing protection against Bordetella pertussis infections. An important unresolved question is, what the effect will be of th
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bordetella parapertussis and Bordetella pertussis are closely related species that cause whooping cough, an acute, immunizing disease. Their coexistence in the same host populations at the same time and vaccine studies showing that B. pertussis vaccines have little effect on B. parapertussis infection or disease suggest that the protective immunity induced by each does not efficiently cross protect against the other. Although the mechanisms of protective immunity to B. pertussis have been well studied, those of B. parapertussis have not. The present study explores the mechanism by which B. par
СтатьяПоддержка NIH: внешняя программаПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pertussis (or whooping cough) is a contagious disease mainly affecting infants and children and predominantly caused by Bordetella pertussis followed by Bordetella parapertussis. B. parapertussis causes a milder cough but usually symptomatically appears like B. pertussis infection. Thus the epidemiology of illness caused by B. parapertussis is not well understood. In this study, a sensitive and specific method for the rapid diagnosis of B. parapertussis is presented. The covalent immobilization of thiol-terminated DNA oligonucleotides (ss DNA SAM) on a silicon surface by disulfide bond formati
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pertussis causes recurrent outbreaks worldwide. Clinical surveillance can be affected by healthcare-seeking behaviour, diagnostic practices, testing sensitivity, and reporting delays. This study evaluated the utility of wastewater surveillance (WWS) by quantifying Bordetella-associated IS481 and IS1001 DNA concentrations. Weekly wastewater samples were collected from four treatment plants in Osaka Prefecture, Japan, between April 2023 and July 2025, and IS481- and IS1001-associated DNA concentrations were measured using quantitative PCR. The putative B. pertussis-associated IS481 DNA concentra
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bordetella parapertussis is a respiratory-disease pathogen producing symptomatology similar to that of pertussis but of underestimated incidence and with no specific vaccine existing. We recently designed a vaccine candidate from B. parapertussis outer-membrane vesicles (OMVs) that proved to be safe and protective in a murine-infection model. Based on protection recently reported for the B. parapertussis O antigen in aqueous solution, we assessed here whether the B. parapertussis O-antigen-containing lipopolysaccharide (BppLPS-O+) embedded in the membranes, as present in B. parapertussis-deriv
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were diff
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
B. parapertussis is a bacterium that causes whooping cough, a severe respiratory infection disease, that has shown an increased incidence in the population. Upon transmission through aerosol droplets, the initial steps of host colonization critically depend on the bacterial adhesins. We here described BPP0974, a B. parapertussis protein that exhibits the typical domain architecture of the large repetitive RTX adhesin family. BPP0974 was found to be retained in the bacterial membrane and secreted into the culture medium. This protein was found overexpressed in the avirulent phase of B. parapert
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bordetella parapertussis is one of the pathogens that cause whooping cough. Even though its incidence has been rising in the last decades, this species remained poorly investigated. This study reports the first extensive proteome analysis of this bacterium. In an attempt to gain some insight into the infective phenotype, we evaluated the response of B. parapertussis to iron starvation, a critical stress the bacteria face during infection. Among other relevant findings, we observed that the adaptation to this condition involves significant changes in the abundance of two important virulence fac
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Pertussis, or whooping cough, is a global public health concern. Pertussis vaccines have demonstrated good protection against Bordetella pertussis infections, but their effectiveness against Bordetella parapertussis remains debated due to conflicting study outcomes.
METHODS: A systematic review and meta-analysis were conducted to assess the effectiveness of pertussis vaccines in protecting children against B. parapertussis infection. A comprehensive search of PubMed, Web of Science, and Scopus databases was conducted, and randomized controlled trials (RCTs) and observational studi
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Studies have documented that older children and adolescents act as a reservoir of Bordetella pertussis infection for young infants who have not yet completed their primary immunization schedule. Asymptomatic pertussis infection has been reported during outbreaks. This cross-sectional study aimed to investigate whether B. pertussis and Bordetella parapertussis can colonize the nasopharynx of healthy school children, using culture and pooled real-time PCR with targets for insertion sequences IS481 and IS1001.
METHODS: Nasopharyngeal (NP) swabs were taken from 629 asymptomatic school
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
B. parapertussis is one of the etiologic agents of whooping cough and its incidence has increased following the COVID-19 pandemic. Since current pertussis vaccines fail to induce protection against B. parapertussis, the course of infection critically relies on the innate immune response. However, in the absence of opsonic antibodies, B. parapertussis fails to activate resting neutrophils, thereby preventing bactericidal responses. We here investigated whether neutrophil priming with gamma-interferon (IFN-γ), the main proinflammatory cytokine present during infection, changes this outcome. We o
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report three Bordetella parapertussis genome sequences obtained from national pertussis surveillance in Colombia during an increase in confirmed cases not linked to outbreaks.
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяRetraction NoticeПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.