Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
189 публикаций
Поиск: 56 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 17 с найденным полным текстом
13C-enriched deoxyribonucleosides have been isolated from the DNA of Algal cells grown in an atmosphere of 90% 13C-labelled carbon dioxide. The 13C enriched DNA was quantitatively hydrolysed with DNase I, snake venom phosphodiesterase I and alkaline phosphatase of intestinal mucosa. The resulting deoxyribonucleosides were separated by preparative reversed-phase high pressure liquid chromatography in 60 minutes with detection by ultraviolet absorption at 254 nm. The final products were obtained in milligram quantities in high purity and in high yield. The 1H resonances of the base and sugar pro
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Diastereomeric dithymidine methanephosphonamidates (TnpmT) were synthesized by reaction of 3'-amino-3'-deoxythymidine with 3'- O -acetylthymidin-5-yl-methanephosphonochloridate. Separated dinucleotide TnpmT(fast) and TnpmT(slow) diastereomers were used as building blocks to prepare chimeric dodecathy-midylates, possessing one to four modified linkages, by means of phosphoramidite automated solid phase synthesis. As expected, the methanephosphonamidate internucleotide linkage is resistant to nuclease P1, snake venom PDE and 3'-exonuclease from human plasma. Degradation of dodecathymidylates pos
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Since their discovery as potential antiviral agents in the early 1990s, L-nucleosides have been developed as treatments for various viruses including hepatitis B virus (HBV) due to their efficacy and lower toxicity compared to their D-enantiomers. One prominent L-nucleoside is telbivudine (LdT), also known as L-thymidine, and is used for the treatment of chronic HBV infections. However, telbivudine, like many other L-nucleosides, is prone to the development of drug resistance due to commonly occurring point mutations. Additionally, for both LdT and its cytidine analogue, antiviral activity has
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The lack of effective treatments for mitochondrial disease has seen the development of new approaches, including those that aim to stimulate mitochondrial biogenesis to boost ATP generation above a critical disease threshold. Here, we examine the effects of the peroxisome proliferator-activated receptor γ (PPARγ) activator pioglitazone (PioG), in combination with deoxyribonucleosides (dNs), on mitochondrial biogenesis in cybrid cells containing >90% of the m.3243A>G mutation associated with mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). PioG + dNs combination
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Syntheses and base pairing properties of halogenated and nonhalogenated hypoxanthine nucleosides with 8-aza-7-deazapurine skeleton (dI*) are reported. Modified hypoxanthine nucleosides were accessed from 6-alkoxy precursors. Single-crystal X-ray analyses disclosed unit cells consisting of two conformers adopting high-anti conformation around the glycosylic bond with N-type C3'-endo (3T2) or E-type, O4'-endo (0E) sugar puckering. Crystal packing is stabilized by inosine/inosine wobble base pairs as well as intermolecular and intramolecular hydrogen bonds. Hirshfeld surface analyses confirmed th
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Immune system regulation is a key indicator of the gut microbiota (GM) influencing disease development. The causal role of the GM in Guillain-Barré syndrome (GBS) and whether it can be mediated by immune cells is unknown. Genome-wide association study (GWAS) summary statistics for the GM were obtained from the Dutch Microbiota Project (n = 7,738) and the FINRISK 2002 (FR02) cohort (n = 5,959). Inverse variance weighting method (IVW) were used as the main method to evaluate the causal relationship between GM and GBS. Subsequently, the mediating effects of 731 immune traits were evaluated. Addit
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Suicide gene therapy in cancer can selectively kill tumors without damaging normal tissues. Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK), an original suicide kinase, makes use of the carcinomatous suicide gene therapy for broader substrate specificity and a higher catalytic rate.
METHODS: To enhance the anti-tumor efficacy of Dm-dNK and maintain its substrate specificity and safety control in the meantime, the conditionally replicative gene-viral system, ZD55-dNK (which contains the selective replication adenovirus, ZD55, encoded with Dm-dNK), was inv
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
4-Cyanoindole-2'-deoxyribonucleoside (4CIN) is a fluorescent isomorphic nucleoside analogue with superior spectroscopic properties in terms of Stokes shift and quantum yield in comparison to the widely utilized isomorphic nucleoside analogue, 2-aminopurine-2'-deoxyribonucleoside (2APN). Notably, when inserted into single- or double-stranded DNA, 4CIN experiences substantially less in-strand fluorescence quenching compared to 2APN. Given the utility of these properties for a spectrum of research applications involving oligonucleotides and oligonucleotide-protein interactions (e.g., enzymatic pr
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ozone is a major component of air pollution and carries potentially mutagenic and harmful affects to health. The oxidation of isolated calf thymus DNA (CT-DNA) led to the nearly quantitative loss of normal DNA 2'-deoxyribonucleosides in the following order: T > G > C ≫ A. The major modification of pyrimidines (T, C, and 5-methylcytosine (5mC)) was the corresponding 5-hydroxyhydantoin derivative after complete digestion of DNA to its component 2'-deoxyribonucleosides. The oxidation of 5mC was 2.5-fold more susceptible than C considering the relative mole fraction of 5mC to C in CT-DNA. Other co
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bone marrow cells from 15 patients with normal deoxyuridine (dU) suppression test results, 3 healthy subjects, and 11 patients with megaloblastic anemia caused by vitamin B12 or folate deficiency were examined for misincorporation of uracil into DNA. Cells were incubated with [5-3H] uridine for 2 hours and their DNA extracted. The DNA was hydrolyzed to deoxyribonucleosides with DNase 1, phosphodiesterase and alkaline phosphatase, and any dU present was separated from other deoxyribonucleosides by Aminex A6 chromatography. The quantity of dU/mg DNA and the radioactivity in the dU peak/mg DNA we
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Balanced pools of deoxyribonucleoside triphosphate precursors are required for DNA replication, and alterations of this balance are relevant to human mitochondrial diseases including mitochondrial neurogastrointestinal encephalopathy. In this disease, autosomal recessive TYMP mutations cause severe reductions of thymidine phosphorylase activity; marked elevations of the pyrimidine nucleosides thymidine and deoxyuridine in plasma and tissues, and somatic multiple deletions, depletion and site-specific point mutations of mitochondrial DNA. Thymidine phosphorylase and uridine phosphorylase double
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Автореактивные, аберрантно активированные лимфоциты, которые нацелены на антигены миелина в центральной нервной системе (КНС), являются основными движущими силами аутоиммунного заболевания, множественного склероза (МС). Расширяющиеся клетки, включая активированные лимфоциты, требуют деоксирибонуклеосайд трифосматы (dNTPs) для воспроизведения ДНК. dNTP могут быть синтезированы по новообразующему пути из прекурсоров, таких, как глюкоза и аминокислоты, или по пути спасения деоксирибонуклеосайда от внеклеточных дексирибонуклеозидов. Deoxytidine cinase (dCK) — энзим, ограничивающий скорость на пути
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиМашинный перевод · не проверен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Desferrioxamine (10(-3) M) caused a fall in the deoxyadenosine triphosphate level after 4 h incubation in normal phytohaemagglutinin-stimulated lymphocytes. There was a rise in the concentrations of the other three deoxyribonucleoside triphosphates (deoxythymidine-,deoxycytidine-and deoxyguanosine-triphosphate). The changes are similar to those caused by hydroxyurea, a known inhibitor of ribonucleotide reductase. Desferrioxamine (10(-3 M) was found to inhibit human lymphocyte ribonucleotide reductase to a mean of 11% of control activity after 45 min incubation. Both drugs, desferrioxamine and
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Brain-infiltrating leukocytes contribute to multiple sclerosis (MS) and autoimmune encephalomyelitis and likely play a role in traumatic brain injury, seizure, and stroke. Brain-infiltrating leukocytes are also primary targets for MS disease-modifying therapies. However, no method exists for noninvasively visualizing these cells in a living organism. 1-(2'-deoxy-2'-18F-fluoroarabinofuranosyl) cytosine (18F-FAC) is a PET radiotracer that measures deoxyribonucleoside salvage and accumulates preferentially in immune cells. We hypothesized that 18F-FAC PET could noninvasively image brain-infiltrat
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Using HPLC methods, we measured the concentrations of nucleosides and nucleotides for a patient with no purine nucleoside phosphorylase (PNP; EC 2.4.2.1) enzymatic activity. Concentrations of inosine and guanosine were abnormally high in urine and plasma, whereas guanosine diphosphate (GDP) and guanosine triphosphate (GTP) concentrations in erythrocytes were depleted. The unusual presence of deoxyribonucleosides (deoxyinosine and deoxyguanosine) and deoxyribonucleotides (dGDP and dGTP) was also notable. Thus, HPLC represents an accurate and useful tool for the study of purine metabolic disorde
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A reverse-phase high-performance liquid chromatographic method has been developed to determine the sites of reaction and the product distribution of modified salmon sperm DNA. The DNA was reacted with methyl methanesulfonate in neutral solution, and then degraded into deoxyribonucleosides by snake venom phosphodiesterase and alkaline phosphatase. Four products were identified and quantitated: 7-methyldeoxyguanosine (37.1%), 7-methylguanine (7.3%), 3-methyldeoxycytidine (28.8%), and 1-methyldeoxyadenosine (26.8%). This method provides a rapid procedure for analysis of chemically or biochemicall
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DNA polymerases typically use deoxyribonucleoside triphosphates (dNTPs) for DNA synthesis, yet the contribution of the γ-phosphate to catalysis remains unclear. Here, we examine the role of substrate energetics in enzyme-catalyzed polymerization using a fidelity-independent model polymerase, terminal deoxynucleotidyl transferase (TdT). Relative to dNTPs, we find that TdT utilizes the canonical deoxyribonucleoside diphosphates (dNDPs) with reduced rates and catalytic efficiencies, but diminished substrate bias. This lower specificity indicates that the γ-phosphate contributes primarily to nucle
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The mitochondrial deoxyribonucleotide (dNTP) pool is separated from the cytosolic pool because the mitochondria inner membrane is impermeable to charged molecules. The mitochondrial pool is maintained by either import of cytosolic dNTPs through dedicated transporters or by salvaging deoxynucleosides within the mitochondria; apparently, enzymes of the de novo dNTP synthesis pathway are not present in the mitochondria. In non-replicating cells, where cytosolic dNTP synthesis is down-regulated, mtDNA synthesis depends solely on the mitochondrial salvage pathway enzymes, the deoxyribonucleosides k
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The synthesis of oligonucleotides (ODNs) containing 5-(N-aminohexyl)carbamoyl-2'-O-methyluridine (D) is described, and thermal stability and resistance to enzymatic hydrolysis of the ODNs are compared with ODNs containing 5-(N-aminohexyl)carbamoyl-2'-deoxyuridine (H). The ODNs containing D and the complementary RNA demonstrated a duplex thermal stabilization of 0.4-3.9 degrees C per modification depending on the position and the number, while the ODNs containing H with the RNA showed slightly less effective thermal stabilization. Further more, the ODNs containing D were found to be more resist
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.