Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
4036 публикаций
Поиск: 371 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 182 с найденным полным текстом
In light of the recent lead contamination of the water in Flint, Michigan and its potential adverse outcomes, much research and media attention has turned towards the safety profile of commonly used chelators. Dimercapto-1-propanesulfonic acid (DMPS) typically used in the treatment of lead, mercury and arsenic poisoning also displays a high affinity towards transition metals such as zinc and copper, essential for biological functioning. It is given in series of dosages (0.2-0.4g/day) over a long period, and has the ability to enter cells. In this work, we investigated the mechanism through whi
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The dicentric chromosome assay (DCA), is considered the 'gold standard' for radiation biodosimetry. Yet, DCA, as currently implemented, may be impractical for emergency response applications, especially when time is of the essence, owing to its labor-intensive and time-consuming nature. The growth of a primary lymphocyte culture for 48 h in vitro is required for DCA, and manual scoring of dicentric chromosomes (DCs) requires an additional 24-48 h, resulting in an overall processing time of 72-96 h for dose estimation. In order to improve this timing. we introduce a protocol that will detect th
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have partially isolated the kinetochore and associated centromeric structures from mammalian metaphase chromosomes. Human autoantibodies from scleroderma CREST (calcinosis, Raynaud's phenomenon, esophageal dysmotility, sclerodactyly, telangiectasia) patients were used as immunofluorescent probes to monitor fractionation. The procedure includes digestion of total chromosomal DNA with micrococcal nuclease, dehistonization with heparin, and dissociation of the remaining material with detergent and urea. We used a density gradient (metrizamide) to obtain an enriched fraction of stained material
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Goal: Chromosomes are intracellular aggregates that carry genetic information. An abnormal number or structure of chromosomes causes chromosomal disorders. Thus, chromosome screening is crucial for prenatal care; however, manual analysis of chromosomes is time consuming. With the increasing popularity of prenatal diagnosis, human labor resources are overstretched. Therefore, an automatic approach for chromosome detection and recognition is necessary. Methods: In the present study, we proposed a deep learning-based system for the automatic chromosome detection and recognition of metaphase cell
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chromosome karyotyping is a critical way to diagnose various hematological malignancies and genetic diseases, of which chromosome detection in raw metaphase cell images is the most critical and challenging step. In this work, focusing on the joint optimization of chromosome localization and classification, we propose ChromTR to accurately detect and classify 24 classes of chromosomes in raw metaphase cell images. ChromTR incorporates semantic feature learning and class distribution learning into a unified DETR-based detection framework. Specifically, we first propose a Semantic Feature Learnin
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chromosomes are bodies that contain human genetic information. Chromosomal disorders can cause structural and functional disorders in individuals. Detecting the metaphase stages of the cells accurately is a crucial step to detect possible defects in chromosomes. Thus, it is vital at this stage to identify the identical chromosome of each chromosome, to perform the pairing process, and to identify problems arising from this process. In this study, it was investigated whether the analyzable metaphase images can be analyzed by using the transfer learning and fine tuning approaches of deep learnin
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To study the feasibility of simultaneous detection for several chromosomes with optimized triple-color primed in situ labelling (PRINS) protocol in cultured peripheral blood lymphocytes.
METHODS: Pre-test of gonosome detection with dual-color PRINS protocol was performed to explore and optimize the order and condition of PRINS primers. A peripheral blood sample from a Klinefelter's syndrome patient (47, XXY) had also been studied with optimized triple-color PRINS to prove the correspondence between the number of signals and chromosomes.
RESULTS: Chromosome 18, X and Y had been sim
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In 1983, a chromosome analysis was carried out in a newborn preterm infant with minor anomalies (preauricular skin tag, maldescensus testis). All analysed metaphases showed a small extra chromosome, which was symmetric, dicentric and bi-satellited. In spite of in depth analysis, its origin remained obscure. Recent re-evaluation using fluorescence in situ hybridization (FISH) led to the diagnosis of a dicentric chromosome 22. The FISH technique is an important new tool in chromosome diagnostics. The phenotype of this infant only vaguely resembles the cat eye syndrome. The syndrome should be dia
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cytogenetic analysis was performed in B-cell mitogen-stimulated leukemic cell cultures from 55 patients with chronic B-lymphocytic leukemia. Clonal chromosomal aberrations were found in the cells of 33 patients, whereas 10 patients were cytogenetically normal. For 12 patients, too few metaphases were found to enable proper evaluation of the karyotype. The patients were subdivided into four groups according to the ratio between the number of metaphases with abnormal and normal chromosome patterns: AA, patients with only abnormal (A) metaphases; A/N high, patients with both abnormal and normal (
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Accurate digital image analysis of abnormal microscopic structures relies on high quality images and on minimizing the rates of false positive (FP) and negative objects in images. Cytogenetic biodosimetry detects dicentric chromosomes (DCs) that arise from exposure to ionizing radiation, and determines radiation dose received based on DC frequency. Improvements in automated DC recognition increase the accuracy of dose estimates by reclassifying FP DCs as monocentric chromosomes or chromosome fragments. We also present image segmentation methods to rank high quality digital metaphase images and
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
As compared to peripheral blood mononuclear cell (PBMC) culture, a lower mitotic index (MI) is seen in whole blood (WB) culture, but WB can be directly used for culture in dicentric chromosome assay (DCA). The purpose of this study is to develop a simple protocol for metaphase enrichment to improve the metaphase frequency of WB culture. Fixed cells were obtained after performing WB and PBMC cultures for DCA after conventional fixation. An additional low-speed centrifugation of 200 × g for 1 min was performed, separating the fixed cells of WB culture into a pellet and a supernatant fraction. Th
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DNA methylation level and pattern of human metaphase chromosomes from extraembryonic tissues (chorionic villi and placental fibroblasts) were analysed in situ. The DNA methylation global level of these tissues was studied by comparing them with the one observed in fetal fibroblasts and adult lymphocytes. In order to assess the tissue specificity and significance of the observed differences, chromosomal preparations were then treated in parallel. They were first stained with distamycin A/DAPI and pictured, then treated with immunofluorescent staining using monoclonal antibodies raised against 5
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Proper oocyte maturation is critical for female fertility, yet whether cuproptosis, a recently identified copper-dependent cell death pathway, affects meiotic maturation remains unknown. Here, we show that Cu(II)-elesclomol (ELC-Cu(II)) treatment induces dose-dependent metaphase I arrest of mouse oocytes. This arrest results from spindle assembly checkpoint activation caused by defective spindle organization and impaired kinetochore-microtubule attachments. We demonstrate that ELC-Cu(II) triggers changes in canonical cuproptosis markers, including intracellular copper accumulation, FDX1 downre
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Chromosomes, cellular structures carrying genetic information, are fundamental to cellular genetics research, with abnormalities potentially causing serious genetic disorders. This makes chromosome screening an essential component in prenatal care for monitoring fetal development and detecting potential genetic abnormalities early in pregnancy. However, manual chromosome analysis is highly inefficient and increasingly burdensome for medical laboratories as prenatal examinations become more common in modern healthcare practices worldwide. Current karyotype analysis systems face sign
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This study compared genetic nurse counsellors with standard services for breast cancer genetic risk counselling services in two regional genetics centres, in Grampian region, North East Scotland and in Cardiff, Wales. Women referred for genetic counselling were randomised to an initial genetic counselling appointment with either a genetic nurse counsellor (intervention) or a clinical geneticist (current service, control). Participants completed postal questionnaires before, immediately after the counselling episode and 6 months later to assess anxiety, general health status, perceived risk and
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
An MRL/MpJ strain of mice, including Ipr mutants, reveals the complex pathological manifestations of collagen disease, such as systemic vasculitis, glomerulonephritis, arthritis and sialoadenitis, in association with several autoimmune factors. Studies involving this mouse strain have shown that it exhibits a much-enhanced healing response compared with other mouse strains, together with reduced scarring in the periphery. Recently, unique characteristics were found in the testis of the MRL/MpJ mouse: metaphase-specific apoptosis (MSA) of meiotic spermatocytes, heat stress resistance in spermat
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Trisomy 12 has been shown to be one of the most common chromosome abnormalities in chronic lymphoid leukemias of B-cell origin, and some studies suggested that it predicts poor overall survival. We have prospectively studied 42 patients with B-cell chronic lymphocytic leukemia (B-CLL) and three patients with B-prolymphocytic leukemia (B-PLL) for the incidence of trisomy 12 and other chromosome 12 aberrations applying fluorescence in situ hybridization (ISH) and conventional G-banding analysis. Dual-color hybridization experiments using centromere-12-specific DNA probes were performed for inter
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.