Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
1466 публикаций
Поиск: 156 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 1376 с найденным полным текстом
Frontiers in bioscience : a journal and virtual library2008eng
Unfortunately, there is no endogenous marker for hepatic clearance that can be used as a guide for drug dosing. In order to predict the kinetic behaviour of drugs in cirrhotic patients, agents can be grouped according to their extent of hepatic extraction. For drugs with a high hepatic extraction (low bioavailability in healthy subjects), bioavailability increases and hepatic clearance decreases in cirrhotic patients. If such drugs are administered orally to cirrhotic patients, their initial dose has to be reduced according to hepatic extraction. Furthermore, their maintenance dose has to be a
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The 5'-RU5 portion of human T-lymphocyte virus type I (HTLV-I) long terminal repeat (LTR) had been reported to contain cis-acting elements for the controlled viral gene expression by the rex gene product. In this study, the human immunodeficiency virus type I (HIV-1) Rev protein was found to enhance gene expression, acting through the 5'-RU5 portion of HTLV-I, while the Rex-responsive element (RxRE)-mediated activation by Rev was reconfirmed to be negative. This positive action of HIV-1 Rev on HTLV-I gene expression seemed to be distinct from the widely accepted Rex or Rev function to facilita
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Spinal muscular atrophy results from the loss of functional survival motor neuron (SMN1) alleles. Two nearly identical copies of SMN exist and differ only by a single non-polymorphic C to T transition in exon 7. This transition leads to alteration of exon 7 splicing; that is, SMN1 produces a full-length transcript, whereas SMN2 expresses a low level of full-length transcript and predominantly an isoform lacking exon 7. The truncated transcript of SMN encodes a less stable protein with reduced self-oligomerization activity that fails to compensate for the loss of SMN1. In this paper, we identif
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Interferon regulatory factor 7 (IRF7), a crucial regulator of type I interferons (IFNs), plays a crucial role in resistance to viral infection. The abnormal production of type I IFNs is associated with many types of disease, such as cancer and inflammatory disorders. Thus, understanding the post-translational modifications of IRF7 is essential to promoting an appropriate immune response. We have recently showed that the TAR RNA binding protein 2 (TARBP2) suppresses IFN-β production and the innate antiviral response by targeting MAVS. Here, we further identified TARBP2 as a novel inhibitor of I
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hepatocellular Carcinoma (HCC), a leading cause of cancer-related death in the world, urgently requires novel therapeutic strategies and drug targets. The TRBP-Dicer complex plays a critical role in miRNA biosynthesis, which can be regulated by small molecules to exert anti-cancer effects. This study presented the structural modification of the natural product (-)-Gomisin M1(GM), resulting in the synthesis of 37 derivatives with a diphenyl amine ester scaffold. Several of these derivatives exhibited enhanced modulation of miRNA biogenesis compared to GM. Notably, derivative 13j displayed impro
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Alternative splicing is a finely regulated process which defines the final maturation of pre-mRNAs. Modulation of trans-acting spliceosome proteins changes specific patterns of splicing and contributes to the development of diseases. During Amyotrophic Lateral Sclerosis (ALS) disease progression, loss of nuclear trans-acting splicing protein TDP43 leads to accumulation of cryptic exons in mRNAs, which inhibits expression of proteins and aggravates the disease. One of the affected genes is DNAJC5, which codes for a protein responsible for clearance of misfolded proteins in the cytoplasm. We fir
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The enterobacterial pathogen Salmonella has long served as a model for bacterial pathogenesis, stress response, gene expression and regulation with extensive investigation involving protein function. With the advent of high-throughput sequencing technologies and their applications in genomics and transcriptomics, a wealth of data particularly with respect to small RNAs (sRNAs) is being generated. These molecules serve as regulators of major stress response and virulence networks in diverse species including Salmonella enterica subsp. enterica serovar Typhimurium (S. Typhimurium) and have recei
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Trans-activation response (TAR) DNA-binding protein 43 (TDP-43) is an RNA-binding protein involved in the processing, transport, and regulation of mRNA translation. It is distributed in many tissues, including the brain, where it is found mainly in hippocampal neurons. Abnormal localization, hyperphosphorylation, and aggregation of TDP-43 are pathological signs of a group of neurodegenerative diseases known as TDP-43 proteinopathies. Despite the growing understanding of the physiological role of TDP-43 in ensuring neuronal plasticity and the formation of long-term memory, to date, there is no
СтатьяОбзорПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Seed size is a key determinant of cereal grain yield, but natural variations in defective-kernel genes have rarely been applied in maize breeding. Here, we report the positional cloning of maize Miniature5 (Mn5), which encodes a mitochondrial-targeted P-class pentatricopeptide repeat (PPR) protein. Further analysis shows that a missense mutation of Mn5, Mn5Val109, presents in maize populations and correlates with reduced seed size. The Mn5Val109 variant exhibits compromised function in the miniature5 (mn5-ref) mutant, failing to trans-splice mitochondrial nad1 intron1, drastically reducing the
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Changes in extracellular glucose levels regulate the expression of the immediate-early response gene and zinc finger transcription factor early growth response-1 (Egr-1) in insulin-producing pancreatic beta-cells, but key target genes of Egr-1 in the endocrine pancreas have not been identified. We found that overexpression of Egr-1 in clonal (INS-1) beta-cells increased transcriptional activation of the rat insulin I promoter. In contrast, reductions in Egr-1 expression levels or function with the introduction of either small interfering RNA targeted to Egr-1 (siEgr-1) or a dominant-negative f
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human T-cell leukemia virus type 1 (HTLV-1) is a complex retrovirus associated with the lymphoproliferative disease adult T-cell leukemia/lymphoma (ATL) and the neurodegenerative disorder tropical spastic paraparesis/HTLV-1-associated myelopathy (TSP/HAM). Replication of HTLV-1 is under the control of two major trans-acting proteins, Tax and Rex. Previous studies suggested that Tax activates transcription from the viral long terminal repeat (LTR) through recruitment of cellular CREB and transcriptional coactivators. Other studies reported that Rex acts posttranscriptionally and allows the cyto
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Expression of the myometrial gap junction protein connexin-43 (Cx-43) increases dramatically with the onset of labor in association with an increase in the plasma estrogen to progesterone ratio. Moreover, we reported that the levels of messenger RNA (mRNA) and protein encoded by the Cx-43 gene are regulated positively by estrogen and negatively by progesterone in both pregnant and nonpregnant rats. However, although the Cx-43 gene has been reported to be responsive to estrogen, it does not contain a palindromic estrogen response element. It does, however, contain a consensus activator protein-
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
RNA interference (RNAi) is a powerful tool to silence or minimize gene expression, and palate culture in vitro is an important technique for study of the palate development. Our previous study demonstrated that the gene expression of glucose-regulated protein-78 (Grp78) was downregulation in the all-trans retinoic acid-induced mouse models of cleft palate (CP) during embryogenesis. To find the role of Grp78, the small interfering RNA (siRNA) of this gene carried by fluorescent vector was injected with a microinjector, through which about 30 pmol siRNA was injected into the Institute of Cancer
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human immunodeficiency virus type 1 (HIV-1) Tat transactivation is an essential step in the viral life cycle. Over the past several years, it has become widely accepted that Tat exerts its transcriptional effect by binding the transactivation-responsive region (TAR) and enhancing transcriptional elongation. Consistent with this hypothesis, it has been shown that Tat promotes the binding of P-TEFb, a transcription elongation factor composed of cyclin T1 and cdk9, and the interaction of Tat with P-TEFb and TAR leads to hyperphosphorylation of the C-terminal domain (CTD) of RNA Pol II and increas
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chikungunya virus (CHIKV) is a reemerging alphavirus responsible for large-scale outbreaks in tropical regions. Its RNA replication depends on the assembly of functional replication complexes using the P123 and P1234 polyprotein precursors and their cleavage products, the nonstructural proteins (nsP1-nsP4). To dissect this process, we developed a trans-complementation assay using either plasmid-based expression or tetracycline-inducible stable cell lines expressing individual nsPs to rescue the activities of defective replicases. CHIKV nsP1, as well as nsP1 from closely related alphaviruses su
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
TARBP2 is a RNA-binding protein (RBP) involved in miRNA processing and maturation. TARBP2 plays significant roles in many biological and pathological conditions, including viral expression of HIV-1, microsatellite instability, cancer stem cell properties, and tumor progression. Overexpression of TARBP2 was observed in many cancers such as prostate cancer, cutaneous malignant melanoma, and adrenocortical carcinoma. In addition, TARBP2 was also found to be downregulated in some cancers including colorectal cancer, gastric cancer, Ewing sarcoma, and upper urinary tract urothelial carcinoma. There
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The hepatitis C virus (HCV) is a species of diverse genotypes that infect over 170 million people worldwide, causing chronic inflammation, cirrhosis and hepatocellular carcinoma. HCV genotype 3a is common in Brazil, and it is associated with a relatively poor response to current direct-acting antiviral therapies. The HCV NS3 protein cleaves part of the HCV polyprotein, and cellular antiviral proteins. It is therefore the target of several HCV drugs. In addition to its protease activity, NS3 is also an RNA helicase. Previously, HCV present in a relapse patient was found to harbor a mutation kno
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.