Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
149 публикаций
Поиск: 64 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 1 с найденным полным текстом
Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry1999eng
The heme group of myeloperoxidase shows anomalous optical properties, and the enzyme possesses the unique ability to catalyze the oxidation of chloride. However, the nature of the covalently bound heme macrocycle has been difficult to identify. In this work, the electronic and magnetic properties of the heme groups in oxidized and reduced forms of wild-type and Met243Thr mutant myeloperoxidase and wild-type lactoperoxidase have been investigated using variable-temperature (1.6-273 K) magnetic circular dichroism (MCD) spectroscopy along with parallel optical absorption and electron paramagnetic
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Nitroxyl (HNO), a potential heart failure therapeutic, is known to target cysteine residues to form sulfinamides and/or disulfides. Because HNO-derived modifications may depend on their local environment, we have investigated the reactivity of HNO with cysteine derivatives and C-terminal cysteine-containing peptides at physiological pH and temperature. Our findings indicate that the nature of HNO-derived modifications of C-terminal cysteines is affected by the C-terminal carboxylate. Apart from the lack of sulfinamide formation, these studies have revealed the presence of new products, a sulfo
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A highly regio- and diastereoselective TMSOTf promoted vinylogous Mannich reaction for the synthesis of chiral quaternary 3-aminooxindole butenolides from 2-silyloxy furans and chiral ketimines is described. The method is found to be very efficient and also provides a facile access to sterically challenging 3-aminooxindole butenolides bearing two quaternary centers in continuation. Further, the versatility of the method is demonstrated by the 1,4-addition of nucleophiles on the sterically congested butenolide substructure.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mercury(II) salt mediated opening of cyclopropylcarbinols by an intramolecular sulfinyl group is disclosed. All four diastereomeric stereotriads have been prepared from cis- and trans-disubstituted cyclopropanes. The trisubstituted cyclopropanes also react regio- and stereoselectively to afford products possessing quaternary stereogenic centers. The reaction is clean and general.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hydrogen sulfide (H2S), methanethiol (MeSH) and dimethylsulfide (DMS) are abundant sulfur gases with roles in biogeochemical cycling, chemotaxis and/or climate regulation. Catabolism of the marine osmolyte dimethylsulfoniopropionate (DMSP) is a major source of DMS and MeSH, but both also result from S-methylation of H2S via MddA, an H2S and MeSH S-methyltransferase whose gene is abundant in soil but scarce in marine environments. Here we identify the S-adenosine methionine (SAM)-dependent MeSH and H2S S-methyltransferase 'MddH', which is widespread in diverse marine bacteria and some freshwate
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A visible-light-induced copper-catalyzed sulfonium salts ring-opening radical-triggered tandem cyclization of 1,7-enynes for the synthesis of three types of highly valuable (distal thioethers-containing) heteropolycyclic compounds is described. Preliminary mechanistic studies suggest that the construction of three C-C bonds and a tetracycle in one pot is based on 6-exo-dig cyclization/1,5-hydrogen-atom transfer/5-endo-trig cyclization radical relay processes under mild conditions. The reaction selectivity shifted to the 6-exo-dig cyclization (rather than 1,5-hydrogen-atom transfer) in the pres
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dimethylsulfoniopropionate (DMSP) catabolism by marine Roseobacters is important for global biogeochemical cycling and the climate. Many Roseobacters contain competing DMSP demethylation and cleavage pathways, but only cleavage produces the climate-cooling gas dimethylsulfide. Here, we identify the "switch" regulator in Roseobacters, DmdR, which transcriptionally represses demethylation (dmdA, encoding DMSP demethylase), cleavage (acuI, encoding acryloyl-CoA reductase) and oxidative stress protection (dmdEF, dinB) genes under low intracellular DMSP levels. Increased DMSP levels lead to DMSP cl
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Six chain-extended analogues of the naturally occurring glycosidase inhibitor salacinol, with ring-heteroatom variation, were synthesized for structure-activity studies with different glycosidase enzymes. The syntheses involved the reaction of PMB-protected D- and L- seleno-, thio-, and iminoarabinitol with a benzylidene- and isopropylidene-protected 1,3-cyclic sulfate, derived from commercially available D-sorbitol, in 1,1,1,3,3,3-hexafluoro-2-propanol containing potassium carbonate. Deprotection of the products afforded the novel selenonium, sulfonium, and iminium analogues of salacinol cont
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The extent to which the 2022 mpox outbreak has affected persons without a recent history of male-to-male sexual contact (MMSC) is not well understood. During November 1-December 14, 2022, CDC partnered with six jurisdictional health departments to characterize possible exposures among mpox patients aged ≥18 years who did not report MMSC during the 3 weeks preceding symptom onset. Among 52 patients included in the analysis, 14 (27%) had a known exposure to a person with mpox, including sexual activity and other close intimate contact (eight) and household contact (six). Among 38 (73%) patients
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Клинический случайПисьмо в редакциюПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Five sulfonium ion derivatives with 1,5-anhydro-5-thio-L-fucitol as a core structure were efficiently synthesized as potential alpha-L-fucosidase inhibitors. The key unit, the tri-O-benzyl derivative of L-fucitol, was readily synthesized from methyl alpha-D-mannopyranoside. Alkylation with methyl iodide or 5-methoxycarbonyl-1-pentyl iodide in acetonitrile containing AgBF4 afforded the corresponding alkylated sulfonium tetrafluoroborates. Alternatively, ring opening of three 1,3-cyclic sulfates in 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) containing K2CO3 afforded the corresponding zwitterionic
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Accumulating evidence suggests that abnormal levels of homocysteine are associated with vascular dysfunctions, cancer cell proliferation and various neurodegenerative diseases. With respect to the latter, a perturbation of transition metal homeostasis and an inhibition of catalase bioactivity have been reported. Herein, we report on some of the molecular bases for the cellular toxicity of homocysteine and demonstrate that it induces the formation of sulfcatalase, an irreversible inactive state of the enzyme, without the intervention of hydrogen sulfide. Initially, homocysteine reacts with nati
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We investigated the distribution of phytoplankton species and the associated dimethyl sulfur species, dimethylsulfoniopropionate (DMSP) and dimethylsulfide (DMS) on a cruise into the spring bloom region of the northern North Atlantic (near 47 degrees N, 19 degrees W). The cruise was timed to characterize the relationship between plankton dynamics and sulfur species production during the spring plankton bloom period. At the same time, we measured the DMS concentrations in the atmospheric boundary layer and determined the abundance and composition of the atmospheric aerosol. The water column stu
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dogger Bank itch is an allergic contact dermatitis to the (2-hydroxyethyl) dimethylsulphoxonium ion, a metabolite produced by the marine Bryozoan Alcyonidium diaphanum. The condition may become disabling in affected individuals, who are chiefly fishermen and dock labourers. It involves regions of skin directly exposed to sea water and areas where water may course. As A. diaphanum is common in the coastal waters of Britain, Ireland and neighbouring mainland Europe, it is important for dermatologists to be aware of Dogger Bank itch. Data published in 1966 suggested that 7% of trawler-men at the
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: The purpose of this report is to document the presence of dimethyl sulfide in mouth air as the predominant volatile sulfur compound (VSC) in an asthmatic patient who was regularly taking suplatast tosilate.
STUDY DESIGN: The patient was a 33-year-old woman who complained of bad breath. She had been diagnosed as having asthma and was receiving periodical medical examinations once a month. VSC in her mouth air were measured with a gas chromatograph. Oral physiotherapy was also carried out to remove any oral malodor of which the source was intraoral.
RESULTS: With the improvement in
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The patient was a 59-year-old woman who complained of coughing, sputum production, and dyspnea. Abnormal moving shadows were found by chest radiography. There was prolonged eosinophilia in blood. Eosinophilia was also found in bronchoalveolar lavage fluid, and examination of a specimen obtained by transbronchial lung biopsy revealed eosinophil infiltration in alveolar septal walls, which led to a diagnosis of chronic eosinophilic pneumonia. Because of an attack of bronchial asthma and a high level of IL-5 in serum on admission, the patient was given suplatast tosilate. Symptoms were relieved,
Клинический случайАннотация на английскомСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
As the magic methyl effect is well acknowledged in pharmaceutical molecules, the development of simple and efficient methods for the installment of methyl groups on complex molecules is highly coveted. Hence, we provide a general strategy for radical cascade cyclization of N-(o-cyanobiaryl)acrylamides by utilizing sulfonium salts as the sources of methyl radical and merging photoredox and copper catalysis. This novel protocol can access a wide variety of methylation or remote thioether-substituted benzo-fused N-heterocycle derivatives, which can be easily transformed into diverse highly valuab
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Among various mRNA carrier systems, lipid nanoparticles (LNPs) stand out as the most clinically advanced. While current clinical trials of mRNA/LNP therapeutics mainly address liver diseases, the potential of mRNA therapy extends far beyond─yet to be unraveled. To fully unlock the promises of mRNA therapy, there is an urgent need to develop safe and effective LNP systems that can target extrahepatic organs. Here, we report on the development of sulfonium lipid nanoparticles (sLNPs) for systemic mRNA delivery to the lungs. sLNP effectively and specifically delivered mRNA to the lungs following
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.