The Small Molecule Pathway Database (SMPDB) is an interactive, visual database containing more than 350 small-molecule pathways found in humans. More than 2/3 of these pathways (>280) are not found in any other pathway database. SMPDB is designed specifically to support pathway elucidation and pathway discovery in clinical metabolomics, transcriptomics, proteomics and systems biology. SMPDB provides exquisitely detailed, hyperlinked diagrams of human metabolic pathways, metabolic disease pathways, metabolite signaling pathways and drug-action pathways. All SMPDB pathways include information on
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report here the first three-dimensional structure of alpha-latrotoxin, a black widow spider neurotoxin, which forms membrane pores and stimulates secretion in the presence of divalent cations. We discovered that alpha-latrotoxin exists in two oligomeric forms: it is dimeric in EDTA but forms tetramers in the presence of Ca2+ or Mg2+. The dimer and tetramer structures were determined independently at 18 A and 14 A resolution, respectively, using cryo-electron microscopy and angular reconstitution. The alpha-latrotoxin monomer consists of three domains. The N- and C-terminal domains have been
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Some properties of the blue copper protein plastocyanin from the green alga Scenedesmus have been investigated and compared with that from spinach, including amino acid composition, isoelectric point and copper content. The protein from Scenedesmus contains two, that from spinach four copper atoms per molecular weight of 40000. A combination of sodium dodecylsulfate/polyacrylamide gel electrophoresis and quantification of sulfhydryl groups indicates a strong preference for a species composed of 4 polypeptide chains of identical amino acid composition representing the enzymically active entity.
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Influenza A viruses cause a highly contagious respiratory disease in humans and are responsible for periodic widespread epidemics with high mortality rates. The influenza A virus NS1 protein (NS1A) plays a key role in countering host antiviral defense and in virulence. The 73-residue N-terminal domain of NS1A (NS1A-(1-73)) forms a symmetric homodimer with a unique six-helical chain fold. It binds canonical A-form double-stranded RNA (dsRNA). Mutational inactivation of this dsRNA binding activity of NS1A highly attenuates virus replication. Here, we have characterized the unique structural feat
Сравнительное исследованиеСтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
alpha-Crystallin, a major protein of the eye lens, is known to have chaperone activity in preventing heat-induced aggregation of enzymes and other crystallins. In this study, we investigate the ability of alpha-crystallin to inhibit UV-light-induced aggregation of other lens proteins and the effect of exposure of alpha-crystallin to UV irradiation on its chaperone activity. The chaperone activities of alpha-crystallin preincubated at different temperatures were found to be different and could be correlated with its change in quaternary structure as determined by the fluorescence probe ANS (8-a
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aggregation of alpha-synuclein (αS) into oligomers is critically involved in the pathogenesis of Parkinson's disease (PD). Using confocal single-molecule fluorescence spectroscopy, we have studied the effects of 14 naturally-occurring polyphenolic compounds and black tea extract on αS oligomer formation. We found that a selected group of polyphenols exhibited potent dose-dependent inhibitory activity on αS aggregation. Moreover, they were also capable of robustly disaggregating pre-formed αS oligomers. Based upon structure-activity analysis, we propose that the key molecular scaffold most effe
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abeta peptide is the major component of senile plaques (SP), which accumulate in the brain of a patient with Alzheimer's disease (AD). A recent report indicated that isoflurane enhanced Abeta oligomerization (micro-aggregation) and subsequent cytotoxicity of the Abeta peptide. A separate study showed that a clinically relevant concentration of isoflurane induces apoptosis and increases Abeta production in a human neuroglioma cell line. In vitro studies have indicated that halothane interacts specifically with Abeta peptide to induce oligomerization and that Abeta42 oligomerizes faster than Abe
СтатьяПоддержка исследования: вне правительства СШАОтозванная публикацияПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The androgen receptor (AR) is a ligand-activated transcription factor which is responsible for the androgen responsiveness of target cells. Several types of mutations have been found in the AR and linked to endocrine dysfunctions. Surprisingly, the polymorphism involving the CAG triplet repeat expansion of the AR gene, coding for a polyglutamine (PolyGln) tract in the N-terminal transactivation domain of the AR protein, has been involved either in endocrine or neurological disorders. For example, among endocrine-related-diseases, the PolyGln size has been proposed to be associated to prostate
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The triple helix is a specialized protein motif, found in all collagens as well as in noncollagenous proteins involved in host defense. Peptides will adopt a triple-helical conformation if the sequence contains its characteristic features of Gly as every third residue and a high content of Pro and Hyp residues. Such model peptides have proved amenable to structural studies by x-ray crystallography and NMR spectroscopy, suitable for thermodynamic and kinetic analysis, and a valuable tool in characterizing the binding activities of the collagen triple helix. A systematic approach to understandin
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Vaccine development against dengue virus is challenging because of the antibody-dependent enhancement of infection (ADE), which causes severe disease. Consecutive infections by Zika (ZIKV) and/or dengue viruses (DENV), or vaccination can predispose to ADE. Current vaccines and vaccine candidates contain the complete envelope viral protein, with epitopes that can raise antibodies causing ADE. We used the envelope dimer epitope (EDE), which induces neutralizing antibodies that do not elicit ADE, to design a vaccine against both flaviviruses. However, EDE is a discontinuous quaternary epitope tha
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dengue is the most common viral infection spread by mosquitoes, prevalent in tropical countries. The acute dengue virus (DENV) infection is a benign and primarily febrile illness. However, secondary infection with alternative serotypes can worsen the condition, leading to severe and potentially fatal dengue. The antibody raised by the vaccine or the primary infections are frequently cross-reactive; however, weakly neutralizing, and during subsequent infection, they may increase the odds of antibody-dependent enhancement (ADE). Despite that, many neutralizing antibodies have been identified aga
СтатьяОбзорПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In human αB-crystallin (αB-Cry), the highly conserved residues arginine 69 (R69) and aspartate 109 (D109) are located within a critical motif of α-crystallin domain (ACD), contributing to the subunit interactions and oligomeric assembly. Recently, two missense mutations (R69C and D109H) in human αB-Cry have been reported to cause congenital cataract and myopathy disorders. We used various spectroscopic techniques, dynamic light scattering (DLS), small-angle X-ray scattering (SAXS), gel electrophoresis and transmission electron microscopy (TEM) to show how these mutations cause significant chan
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Exposure to multiple mosquito-borne flaviviruses within a lifetime is not uncommon; however, how sequential exposures to different flaviviruses shape the cross-reactive humoral response against an antigen from a different serocomplex has yet to be explored. Here, we report that dengue-infected individuals initially primed with the Japanese encephalitis virus (JEV) showed broad, highly neutralizing potencies against Zika virus (ZIKV). We also identified a rare class of ZIKV-cross-reactive human monoclonal antibodies with increased somatic hypermutation and broad neutralization against multiple
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The multiple transferable resistance (MTR) pump, from Neisseria gonorrhoeae, is typical of the specialized machinery used to translocate drugs across the inner and outer membranes of Gram-negative bacteria. It consists of a tripartite complex composed of an inner-membrane transporter, MtrD, a periplasmic membrane fusion protein, MtrC, and an outer-membrane channel, MtrE. We have expressed the components of the pump in Escherichia coli and used the antibiotic vancomycin, which is too large to cross the outer-membrane by passive diffusion, to test for opening of the MtrE channel. Cells expressin
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
On the basis of the observation that in the hormonotoxin oLH-gelonin conjugation of the toxin occurs via the alpha-subunit of lutropin, an attempt was made to develop a general method for generation of similar hybrid proteins involving other glycoprotein hormones. In this approach sites suitable for conjugation would be first introduced into the alpha-subunit, hybridized with any native hormone specific beta-subunit of choice (LH-beta, FSH-beta, TSH-beta) following which the toxic component gelonin would be added on in the form of gelonin-S-S-alpha---beta complex. Thus, thiolated lutropin alph
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Over the last decades, malaria parasites have been rapidly developing resistance against antimalarial drugs, which underlines the need for novel drug targets. Thioredoxin reductase (TrxR) is crucially involved in redox homeostasis and essential for Plasmodium falciparum. Here, we report the first crystal structure of P. falciparum TrxR bound to its substrate thioredoxin 1. Upon complex formation, the flexible C-terminal arm and an insertion loop of PfTrxR are rearranged, suggesting that the C-terminal arm changes its conformation during catalysis similar to human TrxR. Striking differences bet
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coronaviruses (CoV) have caused a number of major epidemics in humans and animals, including the current pandemic of coronavirus disease 2019 (COVID-19), which has brought a renewed focus on the evolution and interspecies transmission of coronaviruses. Swine acute diarrhea syndrome coronavirus (SADS-CoV), which was recently identified in piglets in southern China, is an alphacoronavirus that originates from the same genus of horseshoe bats as severe acute respiratory syndrome CoV (SARS-CoV) and that was reported to be capable of infecting cells from a broad range of species, suggesting a consi
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Adaptor protein (AP) complexes sort cargo into vesicles for transport from one membrane compartment of the cell to another. Four distinct AP complexes have been identified, which are present in most eukaryotes. We report the existence of a fifth AP complex, AP-5. Tagged AP-5 localises to a late endosomal compartment in HeLa cells. AP-5 does not associate with clathrin and is insensitive to brefeldin A. Knocking down AP-5 subunits interferes with the trafficking of the cation-independent mannose 6-phosphate receptor and causes the cell to form swollen endosomal structures with emanating tubules
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The multisubunit Golgi-associated retrograde protein (GARP) complex is required for tethering and fusion of endosome-derived transport vesicles to the trans-Golgi network. Mutation of leucine-967 to glutamine in the Vps54 subunit of GARP is responsible for spinal muscular atrophy in the wobbler mouse, an animal model of amyotrophic lateral sclerosis. The crystal structure at 1.7 A resolution of the mouse Vps54 C-terminal fragment harboring leucine-967, in conjunction with comparative sequence analysis, reveals that Vps54 has a continuous alpha-helical bundle organization similar to that of oth
СтатьяResearch Support, N.I.H., IntramuralПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования