Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
429 публикаций
Поиск: 115 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 3 с найденным полным текстом
INTRODUCTION: Fusobacterium necrophorum, a human and animal pathogen, is the primary etiologic agent of bovine liver abscesses and a driving factor for prophylactic antibiotic use in the fed cattle industry. Considering calls to reduce agricultural antibiotic use, we isolated phages capable of killing F. necrophorum as an alternative or complementary biocontrol strategy.
METHODS: Six novel phages (φFN37, φRTG5, φKSUM, φHugo, φPaco, and φBB) were isolated from rumen fluid or ruminal F. necrophorum isolates and subjected to host range testing on both F. necrophorum subspecies. Four F. necrophor
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this study, a new Salmonella phage, NX263, was isolated from sewage. This phage could lyse 90.57% (48/53) of the bacterial strains tested and showed good activity over a wide range of temperature (up to 60°C) and pH (5-10). Phylogenetic analysis showed that it should be classified as a member of the genus Skatevirus. The genome of phage NX263 is 46,574 bp in length with a GC content of 45.52%. It contains 89 open reading frames and two tRNA genes. No lysogeny, drug resistance, or virulence-associated genes were identified in the genome sequence, suggesting that this phage could potentially
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cutibacterium acnes, formerly Propionibacterium acnes, is a Gram-positive bacterium commonly recognized as an important factor in acne vulgaris and infections associated with prosthetic medical devices. With the rise in antibiotic resistance, phage therapy has gained renewed attention as a promising alternative to antibiotics. In addition to a strict lytic cycle, some virulent phages may enter a pseudolysogenic state and exclude superinfections, thereby significantly limiting the applicability of these potential antimicrobial agents. However, the trade-off induced by phage infection of bacteri
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The lytic activity of plague phage II, serovar 3, with respect to 1,800 bacterial strains has been studied: 760 Yersinia pestis strains, 262 Y. pseudotuberculosis strains, 252 Y. enterocolitica strains, 166 Escherichia coli strains, 90 Shigella strains and 270 strains of other species. The phage has been found to lyse 81.8% of Y. pestis strains, 1 Y. pseudotuberculosis strain and 1 Y. enterocolitica strain. The representatives of other 19 bacterial species have proved to be resistant to the phage. Though having a wide range of action within Y. pestis, the phage does not lyse most of the strain
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Burkholderia phage AP3 (vB_BceM_AP3) is a temperate virus of the Myoviridae and the Peduovirinae subfamily (P2likevirus genus). This phage specifically infects multidrug-resistant clinical Burkholderia cenocepacia lineage IIIA strains commonly isolated from cystic fibrosis patients. AP3 exhibits high pairwise nucleotide identity (61.7 %) to Burkholderia phage KS5, specific to the same B. cenocepacia host, and has 46.7-49.5 % identity to phages infecting other species of Burkholderia. The lysis cassette of these related phages has a similar organization (putative antiholin, putative holin, endo
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Shiga toxin-producing Escherichia coli (STEC) are major foodborne pathogens. In response to the need for safe biocontrol strategies, lytic phages have emerged as promising tools for STEC control. This study analyses genomic features of three novel phages, L73, PG3 and A4.3, isolated from cattle farms using STEC strains as hosts. L73 and PG3 were classified as Tequatrovirus, while A4.3 as Vequintavirus. Genomic analyses revealed no markers of lysogeny, antimicrobial resistance, or virulence. Phylogenetic and comparative analyses confirmed close relationships to reference phages of each genus, w
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cyanobacterial blooms dominated by Microcystis spp. pose significant ecological challenges, including the release of toxins and disruption of aquatic food webs. Although Microcystis can exist as free-living single cells or within dense mucilaginous colonies, the drivers and consequences of colony formation remain unclear. Here, we integrated metatranscriptomic datasets from two Microcystis bloom events in Lake Taihu, China, to analyze and to support findings on the functional differences between colonial and single-cell Microcystis. Our results confirmed colony expression profiles were disprop
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
There was rapid efflux of L-leucine, L-phenylalanine, and alpha-methyl-D-glucoside after infection of Salmonella typhimurium with the clear plaque mutant C1 of phage P22. The efflux was similar to that observed with cyanide or arsenate treatment except that there was partial recovery in the case of phage infection and almost complete recovery under the condition of lysogeny. There was no efflux after infection with the temperature-sensitive mutant ts16C1 at nonpermissive temperature. Superinfection of superinfection exclusion negative lysogen (sie A minus sie B minus) with C1 led to efflux, wh
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Non-typhoidal Salmonella (NTS) typically cause self-limiting enterocolitis, but can lead to life-threatening invasive diseases, particularly in sub-Saharan Africa. In Kenya, multidrug-resistant (MDR) NTS strains with increasing non-susceptibility to third-generation cephalosporins pose a growing public health threat. As traditional antimicrobial treatments become less effective, bacteriophages are emerging as a potential alternative. This study aimed to isolate and characterize bacteriophages targeting MDR and extended spectrum-β-lactamase (ESBL)-producing non-typhoidal Salmonella
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Viral entry is a critical step in the infection process. Klebsiella spp. and other clinically relevant bacteria often express complex polysaccharide capsules that act as a barrier to phage entry. In turn, most lytic phages targeting Klebsiella encode depolymerases for capsule removal. This virus-host arms race leads to extensive genetic diversity in both capsules and depolymerases, complicating our ability to understand their interaction. This study exploits the genetic information encoded in Klebsiella prophages to model the interplay between the bacteria, the prophages, and their depolymeras
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Bacteriophages (phages) are one of the most promising alternatives to traditional antibiotic therapies, especially against multidrug-resistant bacteria. Klebsiella pneumoniae is considered to be an opportunistic pathogen that can cause life-threatening infections. Thus, this study aims at the characterization of a novel isolated phage vB_Kpn_ZC2 (ZCKP2, for short).
METHODS: The phage ZCKP2 was isolated from sewage water by using the clinical isolate KP/08 as a host strain. The isolated bacteriophage was purified and amplified, followed by testing of its molecular weight using Puls
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
On the basis of museum strains of the melioidosis agent Pseudomonas pseudomallei, 14 pure lines of bacteriophages were isolated belonging to morphological groups IV and V according to the classification by A. S. Tikhonenko. These phages show a broad bacteriolytic range as far as museum P. pseudomallei cultures are concerned. It was determined that some phages isolated from the same melioidosis culture and belonging to the same morphological type display different bacteriolytic activity. It is demonstrated that some strains of melioidosis agent are characterized by polylysogeny.
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Because of the importance of stannous chloride in various fields of human endeavour, the potential genotoxicity of this reducing agent was evaluated by measurement of either the inactivation or the induction of SOS responses in bacteria. Escherichia coli strains used in this work (wild type, uvrA, recA, lexA and uvrA recA) were treated with stannous chloride; the wild type was found to be the most resistant and the double mutant, the most sensitive strain. As these strains present mutations on specific genes for the repair of DNA, stannous chloride would appear to be capable of inducing and/or
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Results of study of the negative colonies morphology, the structure of corpuscles, antigenic properties, specificity, and the action range permitted to refer the phages obtained from 18 E. coli strain, 1 plaque strain, and 1 pseudotoberculosis bacillus strain to the same group and to identify them with plague phages of serological type 2. Isolation of the same phage type from different bacterial species permits to regard them as "polyhostal" ones. E. coli should be considered as the main carrier of phages belonging to serological type 2. It is suggested that phages existing on microbes belongi
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Percutaneous cable infection of left ventricular assist device (LVAD) patients is a significant source of morbidity, often caused by biofilm-producing or multidrug-resistant bacteria. We hypothesized that bacteriophage viruses can be identified from biological samples of patients with active driveline infection. Six patients with local percutaneous lead infections were enrolled. Microbiological samples were collected from the infected wound and other skin regions. The isolated viral strains and phages from wastewater samples were then tested against the pathogen bacterial cultures in vitro. Bi
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Regulatory RNAs have long been recognized as major post-transcriptional regulators of bacterial physiology, controlling diverse processes including metabolism, stress adaptation, quorum sensing, and virulence. Recent discoveries have expanded their functional repertoire, revealing that both bacterial and phage-encoded regulatory RNAs contribute to multiple aspects of host-(bacterio)phage interactions. Beyond regulating cellular physiology, regulatory RNAs influence bacterial defense through immune regulation, RNA-guided immunity, dormancy, and abortive infection pathways, while phage-encoded r
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.