Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
7795 публикаций
Поиск: 238 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 271 с найденным полным текстом
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Письмо в редакциюПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Piroplasmosis in cattle is caused by tick-borne haemoprotozoan parasites of the genera Theileria and Babesia. Molecular detection techniques offer higher sensitivity and specificity than microscopy examination methods and serological tests. A reverse line blot (RLB) macroarray that included generic and species-specific probes for Theileria annulata, Theileria buffeli, Babesia bovis, Babesia bigemina, Babesia divergens and Babesia major was used to study the presence and identity of the piroplasm species infecting 263 bovine blood samples from 79 farms, most of them in Northern Spai
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Microarray analysis has provided a novel means of identifying clues into the mechanisms of disease development. As a methodology, microarray analysis holds the promise for genome-wide screening in which 2 tissues (diseased and normal) are compared, and molecular pathways that defined the phenotype of the disease could be precisely defined. Alternatively, microarray experiments can be used to differentially compare pathologically similar diseased tissues to predict response to chemotherapy and risk of recurrence. However, the clinician should be aware that various sources of error can influence
СтатьяResearch Support, N.I.H., IntramuralПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To develop a DNA microarray technique for fast diagnosis of plague.
METHODS: Restriction display polymerase chain reaction (RD-PCR) and hybridization with fluorescently labeled cy5 were employed for detecting the sample DNA of Yersinia pestis, Yersinia pseudotuberculosis and Yersinia enterocolitica.
RESULTS: The prepared microarray is capable of distinguishing Yersinia pestis from Yersinia pseudotuberculosis and Yersinia enterocolitica in the same genus.
CONCLUSION: The constructed DNA microarray is an effective diagnostic tool for the detection of Yersinia pestis.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
КомментарийНовостьПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hereditary retinal diseases (HRDs), including retinitis pigmentosa, Leber's congenital amaurosis, congenital stationary night blindness, vitelliform macular dystrophy, Stargardt macular dystrophy, etc., are the most common and severe hereditary ocular diseases, which are closely associated with blindness. With the accomplishment of human genome project and the widespread application of genetic study techniques, the way leading to understanding of gene mutations of HRDs has been paved. Many encouraging breakthroughs of gene therapy studies have been made. Among them, the arrayed primer extensio
Аннотация на английскомСтатьяОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To determine the bioinformatical characteristics of differential gene expression in patients with chronic superficial gastritis (CSG) with the Pi-deficiency syndrome (PDS) and those of the non-Pi-deficiency syndrome (non-PDS), i.e. patients of CSG with Pi-Wei dampnese-heat syndrome and healthy persons.
METHODS: With the BRB-Array Tools software package, original data collection and bioinformatic: analysis of gene arrays were conducted in 6 CSG patients of PDS (CSG-PDS), 6 CSG patients of non-PDS (CSG-nPDS), and 6 healthy volunteers (Normal).
RESULTS: Compared with non-PDS, the gen
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cryptococcal meningitis affects normal hosts and immunocompromised patients exhibiting high mortality rates. The objective of this study was to design two molecular assays, visible microarray platforms and loop-mediated isothermal amplification (LAMP), to identify Cryptococcus spp. and the species neoformans and gattii from the cerebral spinal fluid (CSF). To identify Cryptococcus and the two species, we designed two microarrays DNA platforms based on the internal transcribed spacer (ITS) region and CAP59 gene and LAMP assays specific for Cryptococcus species. The assays were tested using CSF
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder. Although most patients present with isolated CH, some patients present with CH and extra-thyroidal congenital malformations (ECMs), for which less is known about the underlying genetics. The aim of this study was to investigate the genetic mechanisms in patients with CH and ECMs using chromosomal microarray (CMA) and whole exome sequencing (WES).
METHODS: Peripheral venous blood samples were collected from 16 patients with CH and ECMs. Genomic DNA was extracted from peripheral blood leukocytes. CMA and
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of or
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aptamers are oligonucleotides derived from an in vitro evolution process called SELEX. Aptamers have been evolved to bind proteins which are associated with a number of disease states. Using this method, many powerful antagonists of such proteins have been found. In order for these antagonists to work in animal models of disease and in humans, it is necessary to modify the aptamers. First of all, sugar modifications of nucleoside triphosphates are necessary to render the resulting aptamers resistant to nucleases found in serum. Changing the 2'OH groups of ribose to 2'F or 2'NH2 groups yields a
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: Four intrinsic molecular subsets (inflammatory, fibroproliferative, limited, normal-like) have previously been identified in SSc and are characterized by unique gene expression signatures and pathways. The intrinsic subsets have been linked to improvement with specific therapies. Here, we investigated associations between baseline demographics and intrinsic molecular subsets in a meta-analysis of published datasets.
METHODS: Publicly available gene expression data from skin biopsies of 311 SSc patients measured by DNA microarray were classified into the intrinsic molecular subsets
МетаанализСтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To define the gene expression characteristics in the peripheral blood of patients with lumbar disc extrusion (LDE) and the effect of nonoperative treatment on the gene expression.
METHODS: DNA microarray was used to identify semi-quantitatively the differentially expressed genes (DEGs) in the peripheral blood of patients with LDE and that of the healthy controls and the variation trend of these DEGs after nonoperative treatment. Enrichment analysis was done to reveal the functional characteristics of these DEGs, and network analysis was done to identify key genes that contribute to
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
New generation genomic platforms enable us to decipher the complex genetic basis of complex diseases and Balkan Endemic Nephropathy (BEN) at a high-throughput basis. They give valuable information about predisposing Single Nucleotide Polymorphisms (SNPs), Copy Number Variations (CNVs) or Loss of Heterozygosity (LOH) (using SNP-array) and about disease-causing mutations along the whole sequence of candidate-genes (using Next Generation Sequencing). This information could be used for screening of individuals in risk families and moving the main medicine stream to the prevention. They also might
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Here we report the use of a multi-genome DNA microarray to investigate the genome diversity of Bacillus cereus group members and elucidate the events associated with the emergence of Bacillus anthracis the causative agent of anthrax-a lethal zoonotic disease. We initially performed directed genome sequencing of seven diverse B. cereus strains to identify novel sequences encoded in those genomes. The novel genes identified, combined with those publicly available, allowed the design of a "species" DNA microarray. Comparative genomic hybridization analyses of 41 strains indicate that substantial
СтатьяПоддержка NIH: внешняя программаПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The areas of the pathogenicity island (PAI) designated as 'colonization region' (CR) and 'toxicogenic region' (TR) [Lerat et al. (2009) Mol. Plant Pathol. 10, 579-585] contain genes required for virulence and phytoxin production, respectively, in Streptomyces spp. causing common scab on potatoes. The PAI was tested for genetic variability by microarray analysis in strains of S. turgidiscabies isolated from potatoes in Finland. The data revealed four types of PAI based on divergent CR and TR which occurred in different combinations. Only one PAI type was highly similar to S. scabies (strains 87
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE OF REVIEW: To describe recent advances in the understanding of the pathogenesis of the most common malignant lymphomas that occur as primary and secondary tumors in ocular tissues.
RECENT FINDINGS: Advances have been made in the understanding of the genetic alterations in mucosa-associated lymphoid tissue lymphomas, including various chromosomal translocations, such as the most recently described t(3;14)(p14.1;q32) involving the FOXP1 gene. Further, the development of ocular adnexal mucosa-associated lymphoid tissue lymphomas has been associated with Chlamydia psittaci in some geograp
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Microarray technology is a tremendously powerful method for simultaneously monitoring the expression of thousands of species of nucleic acids, usually cellular mRNA, producing a high-resolution representation of the genes encoded or expressed in a cell. As such, microarray technology has great potential for impacting research and clinical approaches to treatment. However, this complex technology has been challenging to apply as a result of difficulties discerning biologic variation from technologic issues, therefore slowing the application of the technology to human diagnostics. Nevertheless,
СтатьяОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The 1-phenyl-3-methyl-5-pyrazolone (PMP) method has many advantages over hitherto reported methods based on reductive amination and hydrazone formation. This short review summarizes the various aspects of the PMP method, including the principle of derivatization, the simplicity of derivatization procedure, the high sensitivities to UV monitoring and ESI-MS, and the diversity of separation modes in capillary electrophoresis, and presents a number of application data for carbohydrate analysis in biological samples by this method. It also describes successful automation of carbohydrate analysis b
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.