Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
24949 публикаций
Поиск: 154 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 615 с найденным полным текстом
Multiple acyl-CoA dehydrogenase deficiency (MADD) is a heterogeneous group of inborn error of metabolic disease affecting the oxidation of fatty acids and amino acids, and choline metabolism. Genes involved in electrons transfer to the mitochondrial respiratory chain typically induce MADD. Recently, FLAD1, which encodes flavin adenine dinucleotide synthase, has also been reported as a cause of MADD. Here, we present a case of a 28-month girl with progressive weakness in facial and bulbar muscle. She has been suffering from feeding difficulty and recurrent respiratory distress. Lipid storage my
Клинический случайПоддержка исследования: вне правительства СШАСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report the results of a phase 1 dose-escalation study of belinostat and bortezomib in adult patients with acute leukemia or MDS or CML with blast crisis. Thirty-eight patients received IV belinostat days 1-5 and 8-12 with IV bortezomib days 1, 4, 8, and 11 every 21 days. QTc prolongation was the only identified DLT. The RP2Ds were 1.3 mg/m2 bortezomib and 1000 mg/m2 belinostat. One patient with highly refractory MLL-ENL rearranged biphenotypic AML with multiple karyotypic aberrations had a complete pathologic and karyotypic response. One patient with post-MPN AML remained on study with stab
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sex determination is the process by which an initial bipotential gonad adopts either a testicular or ovarian cell fate. The inability to properly complete this process leads to a group of developmental disorders classified as disorders of sex development (DSD). To date, dozens of genes were shown to play roles in mammalian sex determination, and mutations in these genes can cause DSD in humans or gonadal sex reversal/dysfunction in mice. However, exome sequencing currently provides genetic diagnosis for only less than half of DSD patients. This points towards a major role for the non-coding ge
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
There are many unknown genetic factors that lead to infertility in nonobstructive azoospermia men. Here, we performed whole-exome sequencing in blood samples obtained from 40 azoospermia patients with meiotic arrest and found a novel c.151_154del (p.D51fs) frame-shift mutation in exon 3 of the testis expressed 11 (TEX11) gene in one patient. Sanger sequencing analysis of the patient and 288 fertile men was performed to validate the mutation. Immunohistochemical analysis showed TEX11 expression in late-pachytene spermatocytes and in round spermatids in fertile human testes. In contrast, testes
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
There are many reports suggesting an important role of genetic factors in the etiopathogenesis of essential tremor (ET), encouraging continuing the research for possible genetic markers. Linkage studies in families with ET have identified 4 genes/loci for familial ET, although the responsible gene(s) have not been identified. Genome-wide association studies (GWAS) described several variants in LINGO1, SLC1A2, STK32B, PPARGC1A, and CTNNA3, related with ET, but none of them have been confirmed in replication studies. In addition, the case-control association studies performed for candidate varia
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: We aimed to reveal the underlying genetic defect in a multigenerational Chinese family with autosomal dominant concomitant strabismus complicated by multiple ocular developmental abnormalities.
METHODS: Comprehensive ophthalmic examinations were performed in 14 patients and 24 healthy family members. Whole exome sequencing was performed, and Sanger sequencing was used to confirm the probable mutation in all the family members.
RESULTS: Concomitant strabismus was the predominant phenotype in the affected family members, although the patients also exhibited variable phenotypes, includ
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Myhre syndrome (MS) is a rare autosomal-dominant disorder characterized by short stature, intellectual disability, skeletal anomalies, restricted joint mobility, distinctive facial dysmorphism, and deafness. Early diagnosis of MS is difficult because its features progress and become noticeable at school age. Recently, the SMAD4 gene was identified as the major gene responsible for MS. Herein, we report the first Korean case of MS after identification of a SMAD4 mutation by clinical exome sequencing. The patient was born small for gestational age, and she had the typical clinical features of MS
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Congenital disorders of glycosylation (CDG), inherited metabolic diseases caused by defects in glycosylation, are characterized by a high frequency of intellectual disability (ID) and various clinical manifestations. Two siblings with ID, dysmorphic features, and epilepsy were examined using mass spectrometry of serum transferrin, which revealed a CDG type 2 pattern. Whole-exome sequencing showed that both patients were homozygous for a novel pathogenic variant of MAN1B1 (NM_016219.4:c.1837del) inherited from their healthy parents. We conducted a HPLC analysis of sialylated N-linked glycans re
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aim: Cardiovascular disease represents one of the main causes of secondary morbidity and mortality in patients with childhood cancer. Patients & methods: To further address this issue, we analyzed cardiovascular complications in relation to common and rare genetic variants derived through whole-exome sequencing from childhood acute lymphoblastic leukemia survivors (PETALE cohort). Results: Significant associations were detected among common variants in the TTN gene, left ventricular ejection fraction (p ≤ 0.0005), and fractional shortening (p ≤ 0.001). Rare variants enrichment in the NOS1, ABC
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
NudE Neurodevelopment Protein 1 (NDE1) gene encodes a protein required for microtubule organization, mitosis, and neuronal migration. Biallelic pathogenic variants of NDE1 gene are associated with structural central nervous system abnormalities, specifically microlissencephaly and microhydranencephaly. The root of these different phenotypes remains unclear. Here, we report a 20-year-old male patient referred to our clinics due to severe microcephaly, developmental delay, spastic quadriplegia, and dysmorphic features. The cranial computed tomography revealed abnormal brain structure and excess
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cleidocranial dysplasia (CCD) is an uncommon autosomal dominant disease, characterized by hypoplasia of clavicles, delayed fontanelle closure, dental anomalies, and short stature. It has been reported in the literature that the pathogenic variants of Runt-related transcription factor 2 (RUNX2) gene are correlated with CCD patients.Here, we report a consanguineous Chinese family with 2 patients suffering from CCD, presenting similar skeleton and dentition malformation. Upon whole-exome sequencing, 52863 variants were detected in the propositus. Based on the genotype phenotype correlation, a fra
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Severe neonatal episodic laryngospasm (SNEL) is an ion channel disease characterized by recurrent life-threatening myotonia of respiratory muscle due to mutations in the voltage-gated sodium channel genes. Here we reported a newborn manifested as paroxysmal cyanosis and limb myotonia after birth. The neonate also developed muscle hypertrophy and stunted growth during the follow-up. Whole exome sequencing confirmed c.2395G>A, p.Ala799Thr heterozygous mutation of SCN4A. Carbamazepine was found to be effective on treating the disease. This case expands our understanding of the phenotype resulting
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ovotesticular differences of sexual development (OT-DSD) are rare genetic variances defined by the coexistence of both testicular and ovarian tissues. Various molecular etiologies including SRY translocation or SOX9 pathogenic variants with different modes of inheritance have been associated with 46,XX OT-DSD. Here we describe a child diagnosed with SRY-negative 46,XX OT-DSD after completing a series of complex clinical genetic analyses, including chromosomal microarray, DSD gene panel (sequencing and deletion/duplication analysis), whole exome sequencing, and whole genome sequencing. Of these
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Neutral sphingomyelinases have an important role in generation of ceramide and phosphorylcholine from sphingomyelins which then act as secondary messengers in various signaling pathways of the cellular machinery. They function ubiquitously with a predominant role in the central nervous system. Neutral sphingomyelinase type 3, encoded by SMPD4 gene has recently been reported to cause a severe autosomal recessive neurodevelopmental disorder with congenital arthrogryposis and microcephaly. We report a 22-month-old girl having characteristic features of neurodevelopmental delay, prenatal onset gro
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Background: Myhre syndrome is a rare connective tissue disorder caused by heterozygous pathogenic variants in the SMAD4 gene. Although recognizing Myhre syndrome in early childhood is challenging, it is important to manage airway stenosis in patients with Myhre syndrome. Case Presentation: We report the case of a 2-month-old boy who initially presented with severe multilevel airway stenosis, dysmorphic face, and multiple abnormalities. Lung fibrosis and mild aortic valve stenosis were additionally observed on follow-up examinations. A heterozygous missense variant, c.1499T>C (p.Ile500Thr), in
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Myhre syndrome is a rare disorder characterised by short stature, skeletal anomalies, facial dysmorphism and hearing loss (HL), resulting from heterozygous mutations of the SMAD4 gene. We describe the benefits of cochlear implant (CI) in a patient with sensorineural HL carrying a mutation (NM_005359.6: c.1498A>G; p.lle500Val) within the SMAD4 gene, detected by whole-exome sequencing. The CI was inserted through the round window despite otospongiotic abnormalities. Pure-tone audiometry improved up to 20 dBHL. Speech perception in noise (Simplified Noise Reduction - SNR +10) increased from 0% pr
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Isolated complex I deficiency is the most common cause of pediatric mitochondrial disease. Exome sequencing (ES) has revealed many complex I causative genes. However, there are limitations associated with identifying causative genes by ES analysis. In this study, we performed multiomics analysis to reveal the causal variants. We here report two cases with mitochondrial complex I deficiency. In both cases, ES identified a novel c.580G>A (p.Glu194Lys) variant in NDUFV2. One case additionally harbored c.427C>T (p.Arg143*), but no other variants were observed in the other case. RNA sequencing show
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Defects in the PIEZO1 gene cause lymphatic dysplasia in an autosomal recessive manner, mostly by loss-of-function variants. Moreover, since 2019, the role of PIEZO1 in bone formation has been established, but there have been no PIEZO1-related cases presenting definite skeletal involvement to date. A 21-year-old male with primary lymphatic dysplasia had some other distinctive clinical features, including multiple fracture history during infancy, thoracolumbar scoliosis, short stature, and left-sided facial bone hypoplasia. We analyzed the whole exome of the patient and found two novel pathogeni
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sporadic inclusion body myositis (sIBM) is a degenerative, intractable, inflammatory myopathy with an immune pathomechanism. We report on a case of a 44-year-old Japanese man who began developing progressive muscle weakness at age 40. Rheumatoid arthritis symptoms manifested at 43 with strongly positive anti-cyclic citrullinated peptide antibodies. Along with typical sIBM pathology, a muscle biopsy revealed dramatic inflammation with prominent perivascular B-cell infiltration forming ectopic lymphoid follicle-like structures (ELFLSs). Exome sequencing identified no causative variants of heredi
Клинический случайСтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.