Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
31738 публикаций
Поиск: 236 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 5209 с найденным полным текстом
Antipsychotic drugs (APDs) are used to treat many psychiatric illnesses as schizophrenia. Typical antipsychotic drugs (TAPDs) are being used; however, they have many side effects. Atypical antipsychotic drugs (AAPDs) are newer medications with known fewer side effects. Aripiprazole (ARI) is an AAPD, recommended by healthcare providers, even during pregnancy. It can cross the placental barrier and enter fetal circulation, so it might be possible that ARI can adversely impair normal placental development and growth, if it is given prenatally. ARI was applied orally to pregnant female rats in two
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The evolution of the placenta was transformative. It changed how offspring are fed during gestation from depositing all the resources into an egg to continually supplying resources throughout gestation. Placental evolution is infinitely complex, with many moving parts, but at the core it is driven by a conflict over resources between the mother and the baby, which sets up a Red Queen race, fueling rapid diversification of morphological, cellular, and genetic forms. Placentas from even closely related species are highly divergent in form and function, and many cellular processes are distinct. I
СтатьяОбзорПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abnormalities in cellular metabolism are seen early in Alzheimer's disease (AD). Astrocyte support for neuronal function has a high metabolic demand, and astrocyte glucose metabolism plays a key role in encoding memory. This indicates that astrocyte metabolic dysfunction might be an early event in the development of AD. In this paper we interrogate glycolytic and mitochondrial functional changes and mitochondrial structural alterations in patients' astrocytes derived with a highly efficient direct conversion protocol. In astrocytes derived from patients with sporadic (sAD) and familial AD (fAD
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Most of the single point mutations of the LMNA gene are associated with distinct muscular dystrophies, marked by heterogenous phenotypes but primarily the loss and symmetric weakness of skeletal muscle tissue. The molecular mechanism and phenotype-genotype relationships in these muscular dystrophies are poorly understood. An effort has been here to delineating the adaptation of mechanical inputs into biological response by mutant cells of lamin A associated muscular dystrophy. In this study, we implement engineered smooth and pattern surfaces of particular young modulus to mimic muscle physiol
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Animal models of human neurological disorders provide valuable experimental tools which enable us to study various aspects of disorder pathogeneses, ranging from structural abnormalities and disrupted metabolism and signaling to motor and mental deficits, and allow us to test novel therapies in preclinical studies. To be valid, these animal models should recapitulate complex pathological features at the molecular, cellular, tissue, and behavioral levels as closely as possible to those observed in human subjects. Pathological states resembling known human neurological disorders can be induced i
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dilated cardiomyopathy (DCM), a form of non-ischaemic myocardial disease, is characterised by structural and functional cardiac abnormalities. As defined by the World Health Organisation, DCM constitutes a significant cardiac pathology, leading to increased morbidity and mortality due to complications such as heart failure and arrhythmias. The diagnostic process for DCM predominantly employs echocardiography and MRI, with biomarkers like NT-pro BNP and troponin providing supportive, yet non-specific, evidence. Exosomes, small extracellular vesicles, play a critical role in intercellular commun
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osmotic stress, caused by the lack of water or by high salinity, is a common problem in plant roots. Osmotic stress can be reproducibly simulated with the application of solutions of the high-molecular-weight and impermeable polyethylene glycol. The accumulation of different reactive oxygen species, such as singlet oxygen, superoxide, and hydrogen peroxide, accompany this stress. Among them, singlet oxygen, produced as a byproduct of lipoxygenase activity, has been associated with limiting root growth. To better understand the source and effect of singlet oxygen, we followed its production at
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The removal of antibiotic-resistant bacteria (ARB) and antibiotic-resistance genes (ARGs) using sulfate anion radical (SO4•-)-based advanced oxidation processes has gained considerable attention recently. However, immense uncertainties persist in technology transfer. Particularly, the impact of dichlorine radical (Cl2•-) generation during SO4•--mediated disinfection on ARB/ARGs removal remains unclear, despite the Cl2•- concentration reaching levels notably higher than those of SO4•- in certain SO4•--based procedures applied to secondary effluents, hospital wastewaters, and marine waters. The
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Myocardial infarction (MI) is a leading cause of morbidity and mortality worldwide, and endoplasmic reticulum stress (ERS) and mitochondrial Ca2+ overload have been involved in apoptotic cardiomyocyte death during MI. 13-Methylpalmatine (13-Me-PLT) is a natural isoquinoline alkaloid isolated from Coptis chinensis and has not been systematically studied for their potential pharmacological effects in cardiovascular diseases. We conducted the present study to elucidate whether 13-Me-PLT modulates MI pathology in animal MI and cellular hypoxic models, employing state-of-the-art molecular technique
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Intervertebral disc degeneration is characterized by deterioration in structural support that is potentially followed by stimulated neuronal ingrowth, and dysfunction of cellular physiology in the disc. Discogenic low back pain originates from nociceptors within the intervertebral disc or the cartilage endplate. This narrative review examines the mechanisms of disc degeneration, the association between degeneration and pain, and the current diagnosis and treatment of discogenic low back pain. Mechanisms of disc degeneration include dysregulated homeostasis of the extracellular matrix of the di
СтатьяОбзорПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The primary treatment strategies for melanoma include surgical excision, chemotherapy, and radiotherapy. However, the efficacy of these treatments is often limited by drug resistance, recurrence, and severe side effects. Therefore, we aimed to develop a targeted drug delivery system capable of selectively locating tumor sites to minimize systemic toxicity and enhance therapeutic efficacy. This cell drug delivery system can also deliver chemotherapeutic drugs to the tumor microenvironment.
METHODS: We treated B16F10 cells with hyperosmotic cold shock (HCS) to obtain and characteriz
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Female sexual behaviors in rodents (lordosis and appetitive or "proceptive" behaviors) are induced through a genomic mechanism by the sequential actions of estradiol (E2) and progesterone (P), or E2 and testosterone (T) at their respective receptors. However, non-steroidal agents, such as gonadotropin-releasing hormone (GnRH), Prostaglandin E2 (PGE2), noradrenaline, dopamine, oxytocin, α-melanocyte stimulating hormone, nitric oxide, leptin, apelin, and others, facilitate different aspects of female sexual behavior through their cellular and intracellular effects at the membrane and genomic lev
СтатьяОбзорПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIMS: To evaluate the cell proliferation and death, and structural morphology of the pancreatic islet cells of the rats with hyperglycemia in the first month of life and compare to those of the control rats.
MAIN METHODS: Female Sprague-Dawley newborn rats received Streptozotocin (a beta-cytotoxic drug) at birth for diabetes induction. Control and hyperglycemic animals were euthanized on different days of life: 5, 10, 15, and 30. The pancreas was collected and processed for immunohistochemical analysis of cleaved Caspase-3 (cell death), Ki-67 (cell proliferation), PDX-1 (transcription factor
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The global dengue outbreak is a significant public health concern, with the World Health Organization recording over 3 million cases and a 0.04% case fatality rate until July 2023. The infection rate is anticipated to rise in vulnerable regions worldwide. While live-attenuated vaccines are the current standard, their effectiveness in certain populations is debated. Furthermore, the presence of four closely related dengue virus serotypes can lead to antibody-dependent enhancement, compromising vaccine efficacy. In response, we propose the development of a therapeutic subunit-vaccine based on ep
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chlamydia trachomatis is the most prevalent bacterial sexually transmitted pathogen worldwide. Since chlamydial infection is largely asymptomatic with the potential for serious complications, a preventative vaccine is likely the most viable long-term answer to this public health threat. Cell-free protein synthesis (CFPS) utilizes the cellular protein manufacturing machinery decoupled from the requirement for maintaining cellular viability, offering the potential for flexible, rapid, and de-centralized production of recombinant protein vaccine antigens. Here, we use CFPS to produce the putative
СтатьяПрепринтПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Neurodegenerative tauopathies such as Alzheimer's disease (AD) are caused by brain accumulation of tau assemblies. Evidence suggests tau functions as a prion, and cells and animals can efficiently propagate unique, transmissible tau pathologies. This suggests a dedicated cellular replication machinery, potentially reflecting a normal physiologic function for tau seeds. Consequently, we hypothesized that healthy control brains would contain seeding activity. We have recently developed a novel monoclonal antibody (MD3.1) specific for tau seeds. We used this antibody to immunopurify tau from the
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаResearch Support, N.I.H., IntramuralПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A major bottleneck in drug/gene delivery to enhance tissue regeneration after injuries is to achieve targeted delivery to the cells of interest. Unfortunately, we have not been able to attain effective targeted drug delivery in tissues due to the lack of efficient delivery platforms. Since specific cell-cell interactions exist to impart the unique structure and functionality of tissues and organs, we hypothesize that such specific cellular interactions may also be harnessed for drug delivery applications in the form of cell membrane coatings. Here, we employed neural cell-derived membrane coat
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investig
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DNA-protein crosslinks (DPCs) are frequent and damaging DNA lesions that affect all DNA transactions, which in turn can lead to the formation of double-strand breaks, genomic instability and cell death. At the organismal level, impaired DPC repair (DPCR) is associated with cancer, ageing and neurodegeneration. Despite the severe consequences of DPCs, little is known about the processes underlying repair pathways at the organism level. SPRTN is a protease that removes most cellular DPCs during replication, whereas tyrosyl-DNA phosphodiesterase 1 repairs one of the most abundant enzymatic DPCs,
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coxsackievirus Group B type 5 (CVB5), an important pathogen of hand-foot-mouth disease, is also associated with neurological complications and poses a public health threat to young infants. Among the CVB5 proteins, the nonstructural protein 3D, known as the Enteroviral RNA-dependent RNA polymerase, is mainly involved in viral genome replication and transcription. In this study, we performed immunoprecipitation coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify host proteins that interacted with CVB5 3D polymerase. A total of 116 differentially expressed proteins
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.