Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
165890 публикаций
Поиск: 1357 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 6051 с найденным полным текстом
We describe the outcome of two consecutive pregnancies with a clinical presentation of ornithine transcarbamylase (OTC) deficiency (OTCD) without a molecular diagnosis. A 119kb deletion on Xp11.4 including the OTC gene was detected in the mother. The same deletion was identified in the blood spots from deceased male newborns. In patients with a clinical and biochemical presentation of OTCD and negative OTC sequencing, whole genome or targeted chromosomal microarray analysis (CMA) with coverage of the OTC and neighboring genes should be performed as a reflex test.
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A disease-like syndrome is currently affecting a large percentage of the Ianthella basta populations from the Great Barrier Reef and central Torres Strait. Symptoms of the syndrome include discolored, necrotic spots leading to tissue degradation, exposure of the skeletal fibers, and disruption of the choanocyte chambers. To ascertain the role of microbes in the disease process, a comprehensive comparison of bacteria, viruses, fungi, and other eukaryotes was performed in healthy and diseased sponges using multiple techniques. A low diversity of microbes was observed in both healthy and diseased
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Amphipathic protein toxins from tarantula venom inhibit voltage-activated potassium (Kv) channels by binding to a critical helix-turn-helix motif termed the voltage sensor paddle. Although these toxins partition into membranes to bind the paddle motif, their structure and orientation within the membrane are unknown. We investigated the interaction of a tarantula toxin named SGTx with membranes using both fluorescence and NMR spectroscopy. Depth-dependent fluorescence-quenching experiments with brominated lipids suggest that Trp30 in SGTx is positioned approximately 9 A from the center of the b
СтатьяResearch Support, N.I.H., IntramuralПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Письмо в редакциюПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Noroviruses constitute a genetically diverse group of viruses in the Caliciviridae family, and are recognized as an important cause of acute non-bacterial gastroenteritis worldwide. To date there are no data on the incidence of noroviruses as a cause of gastroenteritis in Bulgaria. Fecal samples from an outbreak, and sporadic cases of diarrhea that occurred between December 2006 and April 2007 were tested for the presence of noroviruses. From a total of 474 stools (341 from sporadic cases and 133 cases from a single outbreak) examined, 72 samples (37 from sporadic cases and 35 from the outbrea
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The maintenance of a low pH in the vagina through the microbial production of lactic acid is known to be an important defense against infectious disease in reproductive age women. Previous studies have shown that this is largely accomplished through the metabolism of lactic acid bacteria, primarily species of Lactobacillus. Despite the importance of this defense mechanism to women's health, differences in the species composition of vaginal bacterial communities among women have not been well defined, nor is it known if and how these differences might be linked to differences in the risk of inf
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Marfan syndrome (MFS) is an autosomal dominant disorder of the extracellular matrix. Allelic variations in the gene for fibrillin-1 ( FBN1) have been shown to cause MFS. To date, over 550 mutations have been identified in patients with MFS and related connective tissue diseases. However, about a half of MFS cases do not possess mutations in the FBN1 gene. These findings raise the possibility that variants located in other genes cause or modify MFS. To explore this possibility, firstly we analyzed FBN1 allelic variants in 12 Japanese patients with MFS, and secondly we analyzed fibrillin-3 gene
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PKD2, the gene defective in the second form of autosomal dominant polycystic kidney disease (ADPKD), has been identified by positional cloning and found to encode an integral membrane protein with similarity to the gene for the more common form of ADPKD and to calcium channels. We have determined the exon-intron structure of the PKD2 gene. PKD2 is encoded in at least 15 exons with the translation start site in exon 1. All the splice acceptor and donor sites conform to the AG/GT rule. We have designed a series of intronic oligonucleotide primers for amplifying the entire coding sequence from ge
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Persistent infection with high-risk human papillomavirus (HR-HPV) is a key driver of cervical carcinogenesis. Human papillomavirus type 39 (HPV-39) infection is relatively prevalent in central China. However, data regarding the genetic variability of HPV-39 in this region remain limited.
METHODS: To characterize the genetic variation of the HPV-39 E6 and E7 genes in central China, samples with single type HPV-39 infection were identified by HPV genotyping prior to amplification. The E6 and E7 genes were amplified by polymerase chain reaction (PCR), followed by Sanger sequencing. T
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The objective of this study was to investigate the application effect of deep learning model combined with different magnetic resonance imaging (MRI) sequences in the evaluation of cartilage injury of knee osteoarthritis (KOA). Specifically, an image superresolution algorithm based on an improved multiscale wide residual network model was proposed and compared with the single-shot multibox detector (SSD) algorithm, superresolution convolutional neural network (SRCNN) algorithm, and enhanced deep superresolution (EDSR) algorithm. Meanwhile, 104 patients with KOA diagnosed with cartilage injury
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prot
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The authors report the cause of and risk factors for mortality in infants with Robin sequence and identify characteristics associated with quality-of-life outcomes.
METHODS: The authors performed an 11-year retrospective review of all infants with Robin sequence treated at a neonatal intensive care unit. Patient characteristics were correlated to mortality and quality-of-life measures. Emergency room visits and hospital admissions were used to assess quality-of-life outcomes. Significant variables were identified by means of univariate analysis.
RESULTS: One hundred eighty-one co
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dyslexia is primarily associated with a phonological processing deficit. However, the clinical manifestation also includes a reduced verbal working memory (WM) span. It is unclear whether this WM impairment is caused by the phonological deficit or a distinct WM deficit. The main aim of this study was to investigate neuronal activation related to phonological storage and rehearsal of serial order in WM in a sample of 13-year-old dyslexic children compared with age-matched nondyslexic children. A sequential verbal WM task with two tasks was used. In the Letter Probe task, the probe consisted of
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mutation hotspots have been a staple of mutation spectra since the introduction of fine structure mutation mapping almost 40 years ago. It has been well established that sequence context is an important determinant of mutational activity at mutagen induced hotspots and coldspots. However, our understanding of the sequence effectors of base substitution hotspots is quite limited. This is because manipulation of the sequence about a hotspot site in a marker gene is restricted by the need to maintain a functional marker. In this work, we describe a generalizable system for studying sequence conte
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Small-cell neuroendocrine cancer (SCNEC) of the uterine cervix is an exceedingly rare, highly aggressive tumor with an extremely poor prognosis. The cellular heterogeneity, origin, and tumorigenesis trajectories of SCNEC of the cervix remain largely unclear. We performed single-cell RNA sequencing and whole-exome sequencing on tumor tissues and adjacent normal cervical tissues from two patients diagnosed with SCNEC of the cervix. Here, we provide the first comprehensive insights into the cellular composition, HPV infection-related features, and gene expression profiles of SCNEC of the cervix a
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Drug-resistant tuberculosis (TB) is a global crisis and a threat to health security. Since conventional drug susceptibility testing (DST) takes several weeks, we herein described a molecular assay to rapidly identify multidrug-resistant (MDR) and extensively drug-resistant (XDR) and reveal transmission associated-mutations of Mycobacterium tuberculosis complex (MTBC) isolates in 6 to 7 hours. An array was designed with 12 pairs of primers and 60 single nucleotide polymorphisms of 9 genes: rpoB, katG, inhA, ahpC, embB, rpsL, gyrA, rrs and eis. We assessed the performance of the array using 176
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tick-borne bacteria are considered to be emerging in camels, but data about their occurrence in Tunisian dromedaries and their infesting ticks remain scarce. In this study, 412 camel blood samples and 327 partially engorged ticks were collected and tested for the presence of Coxiella burnetii and/or related strains, and Rickettsiales bacteria. Coxiella burnetii was detected in 9 Hyalomma impeltatum and 3 H. dromedarii with an overall prevalence rate of 3.6% (12/327). Candidatus Midichloria mitochondrii DNA was identified in 16 H. impeltatum and 10 H. dromedarii with an overall prevalence rate
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: As part of annual cross-sectional Streptococcus pneumoniae carriage surveys in Fiji (2012-2015), we detected pneumococci in over 100 nasopharyngeal swabs that serotyped as '11F-like' by microarray. We examined the genetic basis of this divergence in the 11F-like capsular polysaccharide (cps) locus compared to the reference 11F cps sequence. The impact of this diversity on capsule phenotype, and serotype results using genetic and serologic methods were determined.
METHODS: Genomic DNA from representative 11F-like S. pneumoniae isolates obtained from the nasopharynx of Fijian childr
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cystic echinococcosis (CE) is a medically important parasite-caused human disease. Humans may acquire the infection accidentally by ingestion of E. granulosus eggs. The parasite has a broad range of hosts and genotypes, which may affect its aetiological and biological characteristics. The present study aimed to determine the genetic characteristics of human isolates of E. granulosus in Isfahan, Iran. In this cross-sectional study, 50 surgically removed hydatid cysts were collected from hospitalized patients in Al-Zahra Hospital, Isfahan, Iran, over a period of 2 years (2015-2017). DNA was extr
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.