Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hunter disease, an X-linked recessive lysosomal storage disorder, is caused by a deficiency in iduronate sulfatase activity. Sequence analysis of mRNA of fibroblasts of an intermediate phenotype patient showed a single C1327 to T nucleotide transition. This mutation resulted in a substitution of termination codon for normal arginine at position 443 of the peptide sequence. Expression studies with this abnormal cDNA in fibroblasts from the patient revealed a loss of enzymatic activity and instability of the mutated protein. We posturate that this mutation is probably the cause of the intermedia
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The sulfatase family involves a group of enzymes with a large degree of similarity. Until now, sixteen human sulfatases have been identified, most of them found in lysosomes. Human deficiency of sulfatases generates various genetic disorders characterized by abnormal accumulation of sulfated intermediate compounds. Mucopolysaccharidosis type II is characterized by the deficiency of iduronate 2-sulfate sulfatase (IDS), causing the lysosomal accumulation of heparan and dermatan sulfates. Currently, there are several cases of genetic diseases treated with enzyme replacement therapy, which have ge
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidoses (MPSs) make up a group of lysosomal storage diseases characterized by the aberrant accumulation of glycosaminoglycans throughout the body. Patients with MPSs display various signs and symptoms, such as retinopathy, which is also observed in patients with MPS II. Unfortunately, retinal disorders in MPS II are resistant to conventional intravenous enzyme-replacement therapy because the blood-retinal barrier (BRB) impedes drug penetration. In this study, we show that a fusion protein, designated pabinafusp alfa, consisting of an antihuman transferrin receptor antibody and id
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hunter's syndrome (mucopolysaccharidosis type II) is a rare X-linked lysosomal storage disorder caused by mutations in the iduronate-2-sulfatase (IDS) gene. Motivated by the case of a child affected by this syndrome, we compared the intracellular fate of wild-type IDS (IDSWT) and four nonsense mutations of IDS (IDSL482X, IDSY452X, IDSR443X, and IDSW337X) generating progressively shorter forms of IDS associated with mild to severe forms of the disease. Our analyses revealed formylation of all forms of IDS at cysteine 84, which is a prerequisite for enzymatic activity. After formylation, IDSWT w
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To identify the mutations of iduronate-2-sulfatase (IDS) gene, to reveal its mutation features, and to establish a basis for genetic counseling and prenatal gene diagnosis of Hunter syndrome.
METHODS: Urine glycosaminoglycans (GAGs) assay, PCR and DNA sequencing were performed to detect mutation of IDS gene of the patient and his parents.
RESULTS: The result showed that the patient was: DS(++), HS(++), KS(-), CS(-), and that both of his parents were negative. A frame-shift deletion mutation (1062 del 16) was identified in exon 7 of the patient's IDS gene. His parents' genotypes we
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis type II, commonly called Hunter syndrome, is a rare X-linked recessive disease caused by the deficiency of the lysosomal enzyme iduronate-2-sulphatase (I2S). A deficiency of I2S causes an abnormal glycosaminoglycans accumulation in the body's cells. Although enzyme replacement therapy is the standard therapy, adeno-associated viruses (AAV)-based gene therapy could provide a single-dose solution to achieve a prolonged and constant enzyme level to improve patient's quality of life. Currently, there is no integrated regulatory guidance to describe the bioanalytical assay str
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: Mucopolysaccharidosis type II (MPS II or Hunter syndrome) is a rare lysosomal storage disorder caused by iduronate-2-sulfatase (IDS) deficiency. MPS II causes a wide phenotypic spectrum of symptoms ranging from mild to severe. IDS activity, which is measured in leukocyte pellets or fibroblasts, was reported to be related to clinical phenotype by Sukegawa-Hayasaka et al. Measurement of residual plasma IDS activity using a fluorometric assay is simpler than conventional measurements using skin fibroblasts or peripheral blood mononuclear cells. This is the first study to describe the rel
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis type II (MPS II; Hunter syndrome) is a rare X-linked recessive lysosomal disorder caused by defective iduronate-2-sulfatase (IDS), resulting in accumulation of heparan sulfate and dermatan sulfate glycosaminoglycans (GAGs). Enzyme replacement is the only Food and Drug Administration-approved therapy available for MPS II, but it is expensive and does not improve neurologic outcomes in MPS II patients. This study evaluated the effectiveness of adeno-associated virus (AAV) vector encoding human IDS delivered intracerebroventricularly in a murine model of MPS II. Supraphysiol
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In Hunter syndrome (mucopolysaccharidosis II [MPS-II]), systemic accumulation of glycosaminoglycans (GAGs) due to a deficiency of iduronate-2-sulfatase (IDS), caused by mutations in the IDS gene, leads to multiple somatic manifestations and in patients with the severe (neuronopathic) phenotype, also to central nervous system (CNS) involvement. These symptoms cannot be effectively treated with current enzyme-replacement therapies, as they are unable to cross the blood-brain barrier (BBB). Pabinafusp alfa, a novel IDS fused with an anti-human transferrin receptor antibody, was shown to penetrate
Клиническое исследование II фазыСтатьяРандомизированное исследованиеПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis type II (MPS II) is a neurodegenerative lysosomal storage disorder (LSD) caused by inherited mutations in the iduronate-2-sulfatase (IDS) gene. Approximately two-thirds of patients exhibit severe central nervous system (CNS) involvement and cognitive impairment, which remain unaddressed by conventional enzyme replacement therapy (ERT) due to the inability of wild-type IDS to cross the blood-brain barrier (BBB). To overcome this limitation, we engineered a brain-penetrant IDS variant, eBT-IDS4, which retained enzymatic activity and demonstrated enhanced BBB transcytosis in
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Клинический случайПисьмо в редакциюПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Mutations of the iduronate-2-sulfatase (IDS) gene is the ultimate cause of Hunter syndrome. Clarification of the nature of mutations will create a necessary premise for prenatal gene diagnosis. A mucopolysaccharidosis (MPS) type II patient and his parents from an ethnic minority in Yunnan province were studied to identify their possible mutation in IDS gene to establish the basis for prenatal gene diagnosis.
METHODS: The patient was a boy, 6 years and 10 months old. Urine glycosaminoglycans (GAGs) assay was used for preliminary diagnosis of the patient and his parents with the dise
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis type II (MPS II) is a rare X-linked disorder caused by alterations in the iduronate-2-sulfatase (IDS) gene. In this study, IDS activity in peripheral mononuclear blood monocytes (PMBCs) was measured with a fluorimetric enzyme assay. Urinary glycosaminoglycans (GAGs) were quantified using a colorimetric assay. All IDS exons and intronic flanks were bidirectionally sequenced. A total of 15 mutations (all exonic region) were found in 17 MPS II patients. In this cohort of MPS II patients, all alterations in the IDS gene were caused by point nucleotide substitutions or small d
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis II (Hunter disease), a lysosomal storage disorder caused by a deficiency of iduronate-2-sulfatase (IDS), has variable clinical phenotypes. Nearly 300 different mutations have been identified in the IDS gene from patients with Hunter disease, but the correlation between the genotype and phenotype has remained unclear. We studied the characteristics of 11 missense mutations, which were detected in the patients or artificially introduced, using stable expression experiments and structural analysis. The mutants found in the attenuated phenotype showed considerable residual ac
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Various types of complex genetic rearrangements involving the iduronate-2-sulfatase (IDS) and its homologous pseudogene (IDS2, IDSP1) have so far been reported as the cause of Mucopolysaccharidosis type II (MPS2 or MPS II; Hunter syndrome). When using conventional mutational analyses, the occurrence in intronic regions of these rearrangements can be misleading. Here, we describe a rapid PCR-based method set up to detect possible gene/pseudogene recombinations among a series of Italian male patients who had negative results in the mutation analysis of the IDS gene. Our approach selected eight u
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Deficiency of IDs activity results in Hunter Syndrome (mucopolysaccharidosis type II), a fatal X-linked recessive disorder. We report characterization of 28 cosmids around the IDS locus in Xq28. Four overlapping cosmids have been sequenced in their entirety generating a 130-kb contig. These studies show the fine structure of the IDS gene and identify an IDS pseudogene-like structure located 20 kb distal to the active gene. Two novel genes have also been identified in this sequence, and one of these genes is also locally duplicated. Both homologs are expressed, and a number of alternative trans
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mucopolysaccharidosis II (Hunter syndrome), a lysosomal storage disorder caused by a deficiency of iduronate-2-sulfatase (IDS), has variable clinical phenotypes. Total by nearly 400 different mutations have been identified in IDS gene from patients with Hunter syndrome. Herein, we reported a patient who has a novel mutation in IDS gene with a severe clinical phenotype. Genetic analysis of the IDS gene revealed a novel 1-bp deletion in position c.1053T in exon 8 and resulting in a frameshift with a premature stop codon. Enzyme replacement therapy (ERT) using idursulfase (Elaprase®) was conducte
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.