We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a
Клинический случайСравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Gliostatin/thymidine phosphorylase (GLS/TP) is known to have angiogenic and arthritogenic activities in the pathogenesis of rheumatoid arthritis (RA). The novel oral Janus kinase (JAK) inhibitor baricitinib has demonstrated high efficacy in RA. However, the effect of baricitinib on fibroblast-like synoviocytes (FLSs), a key component of invasive synovitis, has not been still elucidated. This study investigated whether GLS/TP production could be regulated by JAK/signal transducers and activators of transcription (STAT) signaling in FLSs derived from patients with RA. FLSs were cultured and stim
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thymidine phosphorylase (TPase) catalyzes the reversible phosphorolysis of pyrimidine deoxynucleosides to 2-deoxy-d-ribose-1-phosphate and their respective pyrimidine bases. The enzymatic activity of TPase was found to be essential for its angiogenesis-stimulating properties. All of the previously described TPase inhibitors are either pyrimidine analogues that interact with the nucleoside-binding site of the enzyme or modified purine derivatives that mimic the pyrimidine structure and either compete with thymidine or act as a multisubstrate (competitive) inhibitor. We now describe the inhibito
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Platelet-derived endothelial cell growth factor (PD-ECGF)/thymidine phosphorylase (TP) has been implicated in cancer angiogenesis, which is critical for tumor growth and metastasis. We investigated the relationship between the tissue concentration of PD-ECGF/TP and the clinicopathologic status in human lung cancer.
METHODS: The concentrations of PD-ECGF/TP in the tumor extracts of 139 primary human lung carcinomas were measured by using a highly specific and sensitive enzyme-linked immunosorbent assay.
RESULTS: PD-ECGF/TP was detected in the extracts from 137 of 139 specimens at c
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE; OMIM 603041) is a rare inherited metabolic disorder mostly caused by mutations in TYMP gene encoding thymidine phosphorylase (TP) protein that affects the mitochondrial nucleotide metabolism. TP, functionally active as a homodimer, is involved in the salvage pathway of pyrimidine nucleosides. MNGIE-like syndrome having an overlapping phenotype of MNGIE was also described and has been associated with mutations in POLG and RRM2B genes. In the present study, we report the molecular investigation of a consanguineous family including two
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: Capecitabine (CAP), a prodrug, needs to be converted to 5-fluorouracil by several key enzymes, including thymidine phosphorylase (TP). To improve the therapeutic index, potentiation of antitumor activity of CAP is required. In this study, we explored whether lidamycin (LDM), an enediyne anticancer antibiotic, can induce synergistic antitumor effects in combination with CAP in murine breast cancer in vitro and in vivo.
METHODS: Using MTT, cell migration and invasion, siRNA knockdown, and Western blot assays, the in vitro synergistic effects of LDM plus CAP on 4T1(LUC) cells were evalu
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thymidine phosphorylase (TP) is overexpressed in many cancers, promoting metastasis, angiogenesis, and tumor growth, making it a promising therapeutic target for anticancer drug development. In this study, bis-Schiff bases of thiobarbituric acid (3a-3g) were screened for in vitro TP inhibitory activity. In the series, four compounds 3c, 3d, 3b, and 3e exhibited potent inhibition with IC50 values ranging from (IC50 = 2.16 ± 1.94 µM) to (IC50 = 12.27 ± 1.78 µM). Density functional theory (DFT) calculations revealed that nitro-substituted derivatives possess the smallest HOMO and LUMO gaps (2.53-
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial neurogastrointestinal encephalopathy (MNGIE) is a rare metabolic disorder caused by missense mutations in the TYMP gene, leading to the loss of human thymidine phosphorylase (HTP) activity and subsequent mitochondrial dysfunction. Despite its well-characterized biochemical basis, the molecular mechanisms by which MNGIE-associated mutations alter HTP's structural stability, dynamics, and substrate (thymidine) binding remain unclear. In this study, we employ a multiscale computational approach, integrating AlphaFold2-based structural modeling, all-atom and coarse-grained molecular
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The regulatory approval of the delta-like ligand 3 (DLL3)-directed bispecific T-cell engager tarlatamab has positioned DLL3 as a clinically actionable target in small-cell lung cancer (SCLC), yet whether DLL3 is independently prognostic alongside other therapy-relevant proteins in real-world SCLC cohorts remains unknown. We addressed this using standardized mass spectrometry-based absolute quantitation.
METHODS: We applied selected reaction monitoring-mass spectrometry (SRM-MS) to archival formalin-fixed paraffin-embedded tumor tissue from 100 patients with SCLC treated with first
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Preclinical data have indicated a synergistic interaction between docetaxel and capecitabine by means of taxane-induced up-regulation of thymidine phosphorylase (TP). On the basis of such premises, we conducted a phase II trial to determine the activity and tolerability of weekly docetaxel plus capecitabine in patients with metastatic breast cancer (MBC). Furthermore, we explored the relationship between TP tumor expression and benefit from this regimen.
PATIENTS AND METHODS: Patients received docetaxel 36 mg/m(2) i.v. on days 1, 8, and 15 and capecitabine orally 625 mg/m(2) b.i.d
Клиническое исследование II фазыСтатьяМногоцентровое исследованиеПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Thymidylate synthase (TS), thymidine phosphorylase (TP), and dihydropyrimidine dehydrogenase (DPD) are key enzymes in the 5-fluorouracil (5-FU) pathway. The aim of this study was to investigate the mRNA expression of TS, TP, and DPD in tumor and nontumor lung tissue of patients with NSCLC and to determine the potential of these genes as molecular biomarkers.
MATERIALS AND METHODS: The TS, TP, and DPD mRNA expression was analyzed in tumor and nontumor tissue of 91 patients with NSCLC by quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) with β-actin as
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The prognosis of patients with metastatic breast cancer remains poor, and thus novel therapeutic approaches are needed. Capecitabine, which is commonly used for metastatic breast cancer in different settings, is an inactive prodrug that takes advantage of elevated levels of thymidine phosphorylase (TP), a key enzyme that is required for its conversion to 5-fluororacil, in tumors. We demonstrated that histone deacetylase inhibitors (HDACi), including low anticonvulsant dosage of VPA, induced the dose- and time-dependent up-regulation of TP transcript and protein expression in breast cancer cell
Полный текст найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thymidine phosphorylase (TP) is a key enzyme involved in pyrimidine nucleoside metabolism and plays a significant role in angiogenesis, tumor progression, and metastasis. In this study, we synthesized 12 pyrazole-based thiadiazole and thiazole derivatives and evaluated their in vitro TP inhibitory activity. The compounds exhibited IC50 values ranging from 36.67 ± 3.50 μM to 61.23 ± 3.20 μM, with several derivatives showing comparable or superior activity to the standard inhibitor 7-deazaxanthine (IC50 = 38.68 ± 1.12 μM). Structure-activity relationship (SAR) analysis revealed that electron-wit
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this study, we demonstrated that the highest activity of thymidine phosphorylase (TP) was found in peripheral blood mononuclear (PBM) cells followed by that of thrombocytes and granulocytes whereas no activity of TP could be detected in erythrocytes. The activity of TP in leukocytes proved to be intermediate compared to the TP activity observed in PBM cells and granulocytes. The activity of TP also was readily detectable in human fibroblasts.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a metabolic disorder caused by mutations in TYMP, encoding thymidine phosphorylase (TP). In MNGIE patients, TP dysfunction produces systemic thymidine and deoxyuridine accumulation, which ultimately impairs mitochondrial DNA replication and results in mitochondrial dysfunction. To date, only allogeneic hematopoietic stem cell transplantation has demonstrated long-term clinical efficacy, but high morbidity and mortality associated with this procedure necessitate the search for safer alternatives. In a previous study, we demonstrat
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Erythrocyte-encapsulated thymidine phosphorylase (EE-TP) is currently under development as an enzyme replacement therapy for mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive disorder caused by a deficiency of thymidine phosphorylase. The rationale for the development of EE-TP is based on the pathologically elevated metabolites (thymidine and deoxyuridine) being able to freely diffuse across the erythrocyte membrane where the encapsulated enzyme catalyses their metabolism to the normal products. The systemic toxic potential of EE-TP was assessed when adminis
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Сравнительное исследованиеАннотация на английскомСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A series of novel 3-chloro-1H-indazole-based 1,3,4-thiadiazole derivatives (1-15) were synthesized, characterized and evaluated for their inhibitory activity against thymidine phosphorylase and α-glucosidase. Several compounds showed potent dual inhibition, with compound 4 exhibiting the highest activity (IC50 = 4.70 ± 1.34 µM for thymidine phosphorylase and IC50 = 1.38 ± 0.46 µM for α-glucosidase), surpassing the standard inhibitors 7-deazaxanthine (IC50 = 12.42 ± 1.27 µM) and acarbose (IC50 = 5.97 ± 0.35 µM). Moreover, other synthesized derivatives included compounds 9, 2, 1 and 6 all showin
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND/AIM: The efficacy of trifluridine/thymidine phosphorylase inhibitor (FTD/TPI) plus bevacizumab as later-line treatment for metastatic colorectal cancer (mCRC) has been demonstrated. However, little is known about the impact of a usage history of bevacizumab in front-line treatment on the clinical benefit of combining bevacizumab with FTD/TPI.
PATIENTS AND METHODS: A total of 62 patients with mCRC treated with FTD/TPI±bevacizumab was enrolled and assessed for chemotherapeutic efficacy and adverse events.
RESULTS: Regardless of the usage history of bevacizumab in front-line treatmen
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Paget's disease of the vulva and the breast are uncommon conditions. The pathogenesis underlying these diseases is still unclear. Vascular endothelial growth factor-A (VEGF-A), a potent angiogenic factor, has been demonstrated in a variety of tumour cell types and is thought to be involved in tumour expansion. Platelet-derived endothelial cell growth factor/thymidine phosphorylase (PD-ECGF/TP) has also been shown to stimulate angiogenesis.
MATERIALS AND METHODS: Fifty-four cases of Paget's disease of the vulva, including 10 with an associated invasive adenocarcinoma, and 38 cases
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования