Amino acid production directly from N2 is a big challenge in green biomanufacturing. Merging biological nitrogen fixation (BNF) with target amino acid biosynthesis in co-culture system offers a promising solution. Here, we constructed a Nitrogen Fixation-Utilization Coupling (NFUC) system that enabled threonine production directly from N2 and ethanol, by co-culturing engineered Azotobacter vinelandii for BNF and Escherichia coli for threonine biosynthesis. Systematic metabolic engineering increased threonine titer 3.4-fold over the initial co-culture through optimizing NH4+ release, threonine
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Amino acids and their derivatives were probably instrumental in the transition of prebiotic chemistry to early biology. Accordingly, amino acid formation under prebiotic conditions has been intensively investigated. Unsurprisingly, most of these studies have taken place with water as the solvent. Herein, we describe an investigation into the formation and subsequent reactions of aminonitriles and their formylated derivatives in formamide. We find that N-formylaminonitriles form readily from aldehydes and cyanide in formamide, even in the absence of added ammonia, suggesting a potentially prebi
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
One advantage of using the Cry proteins of Bacillus thuringiensis as pesticides is their relatively narrow spectrum of activity, thus reducing the risk of non-target effects. Understanding the molecular basis of specificity has the potential to help us design improved products against emerging pests, or against pests that have developed resistance to other Cry proteins. Many previous studies have associated specificity with the binding of the Cry protein, particularly through the apical regions of domain II, to particular receptors on the midgut epithelial cells of the host insect. We have pre
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Plasma amino acid level changes occur in mild, moderate and severe stages of liver injury in human patients. In animal models, however, data are mainly restricted to severe liver injury models in rats. Here we present the characterization of a rat model of moderate liver dysfunction secondary to alpha-napthylisothiocyanate (ANIT)-induced cholestasis. Rats treated with 30 mg/kg/day ANIT for 3 weeks exhibited a time-dependent increase in plasma alanine aminotransferase (ALT), aspartate aminotransferase (AST) and bilirubin levels and a decrease in albumin concentration. According to a liver dysfu
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Phenylketonuria is the most prevalent inherited defect in amino acid metabolism. Owing to mutations in the gene encoding the enzyme phenylalanine hydroxylase, the essential amino acid phenylalanine cannot be hydroxylated to tyrosine and blood and tissue concentrations of phenylalanine increase. Untreated, phenylketonuria causes severe mental retardation, epilepsy and behavioral problems. The combined effect of neonatal screening and treatment has, however, meant that phenylketonuria is now a biochemical rather than a clinical diagnosis. Treatment consists of stringent dietary restriction of na
Историческая статьяСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the ve
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Escherichia coli, Salmonella enterica, Klebsiella pneumoniaeand Klebsiella oxytocawere found to contain two D-tagatose 1,6-bisphosphate (TagBP)-specific aldolases involved in catabolism of galactitol (genes gatY gatZ) and of N-acetyl-galactosamine and D-galactosamine (genes kbaY kbaZ,also called agaY agaZ). The two aldolases were closely related (> or = 53.8% identical amino acids) and could substitute for each other in vivo. The catalytic subunits GatY or KbaY alone were sufficient to show aldolase activity. Although substantially shorter than other aldolases (285 amino acids, instead of 358
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The tomato Mi gene confers resistance against root-knot nematodes and potato aphids. Chimeric constructs of the functional gene, Mi-1. 2, with a homolog, Mi-1.1, were produced, and their phenotypes were examined in Agrobacterium rhizogenes-transformed roots. Exchange of the leucine-rich repeat (LRR) region of Mi-1.1 into Mi-1.2 resulted in the loss of ability to confer nematode resistance, as did substitution of a 6-amino acid sequence from the Mi-1.1 LRR into Mi-1.2. Introduction of the Mi-1.2 LRR-encoding region into Mi-1.1 resulted in a lethal phenotype, as did substitution of the fragment
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
According to the known amino acid sequence of Bm-12, a short chain insect neurotoxin from the venom of the scorpion Buthus martensi Karsch (BmK) with considerable primary sequence homology to chlorotoxin, the gene specific primers were designed and synthesized for 3' and 5'RACE (Rapid Amplification of cDNA Ends). The two partial cDNA fragments obtained by 3' and 5'RACE were cloned and sequenced, and the full length cDNA sequence of Bm-12 was then completed by overlapping these two partial cDNA sequences. The predicted amino acid sequence consists of 59 amino acid residues including a putative
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve strains of mumps virus, belonging to the A, C and D genotypes of the small hydrophobic (SH) protein gene, were investigated by nucleotide sequencing of the fusion protein gene. The nucleotide sequences and deduced amino acid sequences were aligned and compared with previously reported sequences of the gene. In addition an antigenic comparison between the F protein of different strains of the A, C and D genotypes was performed with ten monoclonal antibodies directed against the F protein of genotype A. Phylogenetic analysis of the coding region of the F gene showed the expected clusterin
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fibrillin-1, the main component of 10-12 nm microfibrils of the extracellular matrix, is synthesized as profibrillin and proteolytically processed to fibrillin. The putative cleavage site has been mapped to the carboxy-terminal domain of profibrillin-1, between amino acids arginine 2731 and serine 2732, by a spontaneous mutation in this recognition site that prevents profibrillin conversion. This site contains a basic amino acid recognition sequence (R-G-R-K-R-R) for proprotein convertases of the furin/PACE family. In this study, we use a mini-profibrillin protein to confirm the cleavage in th
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The SBL-1 strain of mumps virus, grouping with genotype A on the basis of the small hydrophobic protein gene sequence, was grown in the presence of three different monoclonal antibodies. The monoclonal antibodies were directed against the haemagglutinin-neuraminidase (HN) protein and they inhibited haemagglutinating activity and infectivity of the virus. The HN genes of the nine neutralization-escape virus mutants were sequenced and the predicted amino acid sequences were compared with that of the parental virus. Amino acid substitutions were found at positions 269, 352 and 354, respectively,
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To define the autoantibody epitopes in amino acids 513-633 of thyroid peroxidase (TPO), a region frequently recognized in thyroiditis, cDNA sequences coding for peptide fragments of this region were amplified and ligated into pMalcRI and pGEX vectors for expression as recombinant fusion proteins. Western blots and enzyme-linked immunosorbent assay were then used to examine the reactivity in sera from 45 Hashimoto's and 47 Graves' disease patients. Two autoantibody epitopes within TPO amino acids 589-633 were identified; 16 of 35 patients reactive to TPO513-633 recognized the epitope of TPO592-
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To compare the molecular structure of a parasite-derived neutrophil chemotactic factor (NCF) with host-derived NCFs or other NCFs, molecular cloning of cDNA encoding NCF derived from Dirofilaria immitis adult worm (DiNCF) was performed. A D. immitis cDNA library was screened with an antibody to DiNCF, and one DiNCF cDNA clone (pD-4) was isolated. A fusion protein of pD-4 and gene 10 protein showed significant neutrophil chemotactic activity whereas gene 10 protein itself showed marginal neutrophil chemotactic activity. The total nucleotide sequence analysis revealed that pD-4 was 994 bp long w
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of this study was to compare the efficiency of ornithine alpha-ketoglutarate (OKG) and glutamine supplementation in an experimental model of denutrition that provides well-characterized disturbances of amino acid patterns. Male Wistar rats (187 +/- 11 g; five in each group) were starved for 3 days and then refed for 7 days with an oral diet (192 kcal kg-1.day-1 and 2.25 g of nitrogen kg-1.day-1), supplemented with 0.19 g of nitrogen kg-1.day-1 in the form of OKG, glutamine, or casein (control group). Food deprivation induced a fall in most tissue amino acids, with the notable exception
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Phospholipases A(2) (PLA(2)) are major components of snake venoms, exerting a variety of relevant toxic actions such as neurotoxicity and myotoxicity, among others. Since the majority of toxic PLA(2)s are basic proteins, acidic isoforms and their possible roles in venoms are less understood. In this study, an acidic enzyme (BaspPLA(2)-II) was isolated from the venom of Bothrops asper (Pacific region of Costa Rica) and characterized. BaspPLA(2)-II is monomeric, with a mass of 14,212 +/- 6 Da and a pI of 4.9. Its complete sequence of 124 amino acids was deduced through cDNA and protein sequencin
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ciprofloxacin decomposes photochemically in aqueous solutions at acidic pH forming two major degradation products. One of the products, isolated from irradiated solutions by flash chromatography, was 7-[(2-aminoethyl)amino]-1-cyclopropyl-6-fluoro-1, 4-dihydro-4-oxo-3-quinoline carboxylic acid. The compound was an intermediate in the photochemical process, which degraded after longer exposure with a high-pressure mercury lamp to an aromatic amino-compound, 7-amino-1-cyclopropyl-6-fluoro-1, 4-dihydro-4-oxo-3-quinoline carboxylic acid. The structure of the intermediate was elucidated on the basis
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Nucleopeptides Ac-Tyr(p3' dACGT)-Ala-Phe-Gly-NH2, Ac-Thr(p3'dACGT)-Ala-Phe-Gly-OH, Ac-Ser(p3'dACGT)-Ala-Phe-Gly-OH, and Phac-Hse(p3'dACGT)-Ala-Phe-Gly-OH, in which the 3'-end of a tetradeoxyribonucleotide is linked by a phosphodiester bond to a hydroxylated amino acid, were synthesized using a stepwise solid-phase methodology to study the influence of the linking amino acid on their stability to 3'-exonucleases. HPLC analysis of the reaction crudes after treatment of each nucleopeptide with snake venom phosphodiesterase showed that the lability of the amino acid-nucleoside linkage increases in
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Insulin and a 36-residue peptide with homology to pancreatic polypeptide (PP) were isolated from the endocrine pancreas of the alligator gar (Lepisosteus spatula), a ganoid fish, by gel filtration and HPLC. Heterologous radioimmunoassays were used to detect insulin-like and PP-like immunoreactivities during purification of the two peptides. The sequence of the 36-amino acid peptide containing a C-terminal tyrosinamide was identical at 31 of 36 positions to porcine neuropeptide Y (NPY). The amino acid sequence of this peptide is YPPKPENPGEDAPPEELAKYYSALRHYINLITRQRY-NH2. The second peptide, gar
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) is a multifunctional protein with receptor recognition ability that plays an important role in the infection of cells by NDV. An alignment of NDV HN protein sequences of different genotypes showed that vaccine strains of NDV, such as the LaSota strain, generally have an HN protein of 577 amino acids. In comparison, the HN protein of the V4 strain has 616 amino acids, with 39 more amino acids at the C-terminus. In this study, we generated a recombinant NDV (rNDV) with a 39-amino-acid truncation at the HN C-terminus ba
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования