Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
23607 публикаций
Поиск: 187 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 712 с найденным полным текстом
We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a
Клинический случайСравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Three siblings with a family history of consanguinity presented with short stature and two of the patients had leg deformity. None of them experienced ocular or renal symptoms at presentation. After the pediatricians found characteristics of Fanconi syndrome, an ophthalmic consultation was requested Ocular examination revealed typical cystine crystals deposited in the cornea and conjunctivae. No crystal deposits were found elsewhere in the eyes. Fundoscopic examination was normal. Two patients who underwent a complete ocular examination were diagnosed as adolescent cystinosis. The youngest pat
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To describe a distinctive syndrome of nonprogressive encephalopathy, normo- or microcephaly, and early onset of severe psychomotor impairment in 15 white patients, including two siblings and two first cousins.
METHODS AND RESULTS: MRI revealed bilateral cysts in the anterior part of the temporal lobe and white matter abnormalities with pericystic abnormal myelination and symmetric lesions in frontal and occipital periventricular regions. None of the usual inborn errors of metabolism/infectious diseases associated with leukoencephalopathy and bilateral anterior temporal lobe cysts w
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Otto Christian Stengel's (1794-1890) description of four siblings suffering from probable neuronal ceroid lipofuscinosis (Batten disease or Spielmeyer-Vogt disease) is one of the few Norwegian primary reports of neurological disease. Dr. Stengel was a physician in the copper mining town of Roeros in Norway from 1821 to 1883. His report was published in Norwegian in the first volume of the first Norwegian medical journal "Eyr" in 1826, 77 years before Frederick E. Batten (1865-1918) through his publication in 1903 became internationally renowned for giving the first report of the disease. This
БиографияИсторическая статьяСтатьяPortraitПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 39-year old man presented 13 years ago with a history of progressive loss of vision and photophobia. A full ophthalmological and ENT work-up during several years of follow-up, including psychophysical as well as electrophysiological tests, revealed a progressive cone dystrophy in combination with sensorineural hearing loss. His younger sister presented with very similar features and underwent the same work-up. A novel syndrome of progressive cone dystrophy and sensorineural hearing loss is described in both siblings. Both also suffered from non-ocular disease possibly related to ciliary dysf
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Joubert syndrome (JS) is an autosomal-recessive disorder, characterized by hypotonia, ataxia, global developmental delay and molar tooth sign on magnetic resonance imaging. A variety of other abnormalities have been described in children with JS, including abnormal breathing, abnormal eye movements, a characteristic facial appearance, delayed language, hypersensitivity to noise, autism, ocular and oculomotor abnormalities, meningoencephaloceles, microcephaly, low-set ears, polydactyly, retinal dysplasia, kidney abnormalities (renal cysts), soft tissue tumor of the tongue, liver disease and duo
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Occipital lobe and calf muscle energy metabolism were studied in vivo by magnetic resonance spectroscopy (31P-MRS) in four members of a family harbouring the mitochondrial DNA G3460A mutation causing Leber's hereditary optic neuropathy (LHON). Three siblings carried 100% mutated mitochondrial DNA (homoplasmy), while their mother had coexistence of mutated and wild-type mitochondrial DNA (heteroplasmy). Indices of brain energy metabolism on 31P-MRS were abnormal in all subjects examined, but the muscle oxidative phosphorylation rate was normal. These findings indicate a tissue specific distribu
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Atopy, allergy, or asthma rarely can complicate organ transplantation. We identified two patients who developed asthma following bone marrow transplantation. Neither patient had a documented history of allergy, atopy, or asthma, but their donors were human leukocyte antigen-identical siblings who had a history of asthma. Pulmonary function testing revealed decreased airflow. Investigation of the bronchial biopsy specimens revealed eosinophilia and histologic features that were compatible with asthma. No infectious pathogens were identified. Both patients received therapy with bronchodilators a
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Laurence-Moon-Bardet-Biedl syndome is an autosomal recessive condition characterized by retinal dystrophy, obesity, mental retardation, distal limb anomaly, hypogonadism, and renal dysfunction. The symptoms vary among families and even among affected siblings. Certain clinical signs have been used to identify subgroups of patients with this complex condition. Laurence-Moon syndrome as a distinct entity is rare and features paraplegia in the absence of polydactyly or obesity. Bardet-Biedl syndrome is characterized by distal limb anomaly, obesity, and renal involvement, but neurologic symptoms a
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Patients with multiple pregnancies have an increased risk of preterm labor and delivery with the associated high prenatal morbidity and mortality. Obviously, as the number of multifetal pregnancies increases (due primarily to the use of assisted reproductive treatments), a rise in the unexpected birth of one or more siblings at premature or previable stages is observed. In multiple pregnancies with imminent preterm birth, delayed delivery may offer survival chances and a favorable outcome for the remaining fetus(es). Herein, we report on the prolongation of a triplet pregnancy and survival of
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Adiposis dolorosa is a rare condition characterized by multiple painful lipomas. We describe two typically affected siblings who were found to have at least 5 affected first-degree relatives in two generations. Manifestations were remarkably variable, ranging from complete disability to solitary asymptomatic tumors. Review of histopathologic findings did not reveal any features that might distinguish the tumors from common sporadic lipomas. Mutational analysis excluded the 8344 A to G mitochondrial mutation seen in other patients with multiple lipomas. Adiposis dolorosa may be an extreme manif
Клинический случайСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Two examples of hereditary nephropathy within the context of clinical syndromes are described. Emphasis is put on the ability to make a renal diagnosis without renal biopsy and the benefits of screening relatives once a diagnosis is achieved. A variant of Alport's syndrome with associated macrothrombocytic thrombocytopenia, known as Epstein's syndrome, is reported. In addition siblings with Alström's syndrome characterized by pigmentary retinal degeneration (causing blindness in early childhood), progressive sensorineural hearing loss, and progressive renal failure are reported. Both cases had
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dystrophic aortic regurgitation is the result of 2 diseases: (1) aortic regurgitation, consequence of (2) aortic dilatation due to decreased aortic wall resistance. Marfan syndrome, which is a genetic disease, should be looked for systematically, with the help of an ophthalmologist and a rheumatologist. Aortic dilation is responsible for the increased mortality because of aortic dissection. Diagnosis is often made when the aorta is dilated wheras the aortic regurgitation is minimal or moderate; when the patient is asymptomatic. This has 2 consequences: siblings of Marfan patient should be exam
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe cortical malformations in two siblings who also had features of Adams-Oliver syndrome (AOS, MIM 100300). The parents were first cousins and showed no signs of either disorder, suggesting autosomal recessive inheritance. Psychomotor delay was present in both sibs, and cerebral imaging was indicative of polymicrogyria (PMG). One sib had aplasia cutis congenita of the scalp and transverse limb defects, and the other had short fingers and toes and also developed lymphedema of the right leg. CNS abnormalities and lymphatic abnormalities are rare manifestations of AOS, and we suggest tha
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
It is still uncertain how deleted mitochondrial DNA (mtDNA) is distributed to each tissue during development, although deletions of mtDNA have been extensively observed in various pathologic conditions. This paper presents two Japanese siblings with progressive external ophthalmoplegia exhibiting multiple mtDNA deletions. In one patient, similar multiple mtDNA deletions were found in skeletal muscle specimens as well as in the spinal cord but not in the myocardium, liver or leukocytes. A similar deletion pattern was found in the skeletal muscle but not in the leukocytes of the other patient. T
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Lafora body disease is one cause of progressive myoclonus epilepsy. It typically presents in the second decade with generalized seizures, myoclonus and then intellectual decline. Death is usual within 10 years. Diagnosis may be made by biopsy of skin, muscle, liver or brain. We present four siblings who were normal until their mid-twenties, but then developed intellectual decline, followed by myoclonus. Although a rare form of Lafora body disease has been described that follows a more benign course, may be of later onset, and whose pathology is subtly different, this family is so far unique in
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Nine patients with the characteristic signs of fetal akinesia sequence (polyhydramnion, multiple joint contractures and lung hypoplasia) are described. In 8 of the 9 patients nemaline myopathy could be demonstrated with histology. The ninth patient presented the same phenotype as his 4 affected siblings in whom the nemaline myopathy could be histologically proven. Seven of the patients belonged to 2 families; the other 2 patients were isolated cases. In one fetal case nemaline myopathy was documented at week 22 of gestation. These observations demonstrate that nemaline myopathy can cause the f
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 21-year-old patient, since the age of 16, presented a familial type of chronic autoimmune thrombocytopenia that responded only partially to various types of immunosuppressive treatment. His prolonged survival, compared to his decreased siblings, was complicated by the appearance of a severe enteropathy. High doses of corticosteroids induced a type 1 diabetes as a major side effect. The introduction of cyclosporine resulted in both a continuous complete clinical remission and a partial hematological remission and allowed the discontinuation of all other medication for 18 months. In uncommon c
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The locus DXS255 was studied using the probe M27 beta in ten probands with Rett syndrome and in eight of their families. No evidence of uniparental disomy of the X chromosome was detected, as all informative probands had inherited an allele from each of their parents. Differential methylation of a CCGG site within the DXS255 locus as shown by digestion with MspI/HpaII, revealed moderate skewing of X-inactivation favouring the maternal allele in two of the probands. Random X-inactivation was present in all mothers tested and in two unaffected sisters. Three of four unaffected siblings had inher
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report on two siblings, a boy and a girl, with agenesis of corpus callosum and neuronopathy. The children show diffuse hypotonia, delayed motor and mental development. Neurophysiological examinations revealed reduction of the motor nerve conduction velocity, absence of sensory nerve action potentials, abnormal somatosensory and visual evoked potentials. Nerve biopsies showed reduced density of myelinated and unmyelinated fibres in both children. We also found signs of hypomyelination and suggest this is secondary to degeneration of peripheral sensory and motor neurons. Our findings are cons
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.