All living organisms conduct protein synthesis with a high degree of accuracy maintained in the transmission and flow of information from a gene to protein product. One crucial 'quality control' point in maintaining a high level of accuracy is the selectivity by which aminoacyl-tRNA synthetases furnish correctly activated amino acids, attached to tRNA species, as the building blocks for growing protein chains. When differences in binding energies of amino acids to an aminoacyl-tRNA synthetase are inadequate, editing is used as a major determinant of enzyme selectivity. Some incorrect amino aci
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Autoantibodies to three of the aminoacyl-transfer RNA (tRNA) synthetases have been reported (for histidine, threonine, and alanine). Most patients with these autoantibodies have polymyositis, and the majority also have interstitial lung disease. This study examined the question of whether autoantibodies to other aminoacyl-tRNA synthetases occur in the sera of myositis patients. We tested sera from patients with myositis with unidentified anticytoplasmic antibodies that immunoprecipitate tRNA for the ability to inhibit the aminoacyl-tRNA synthetases for the remaining 17 amino acids. Three sera
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The oligonucleotides obtained by digestion of tRNA2Leu from cow mammary gland with T1 RNase were separated by micro-column chromatography on DEAE-cellulose in 7 M urea at pH 7,5 and 3,7, and in addition on Dowex 1 x 2. The digest consisted of 18 individual components, the larger being a tridecanucleotide. Micro-column chromatography of nucleotides on anion-exchanger AG 1 x 8 and nucleosides on Aminex A-6 was used to determine the base composition of the oligonucleotides. The oligonucleotide structure was established using terminal analysis, hydrolysis by pancreatic and U2-RNases and incomplete
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hereditary peripheral neuropathies called Charcot-Marie-Tooth (CMT) disease affect the sensory nerves as well as motor neurons. CMT diseases are composed of a heterogeneous group of diseases. They are characterized by symptoms such as muscle weakness and wasting. Type 2 CMT (CMT2) disease is a neuropathy with blunted or disrupted neuronal morphological differentiation phenotypes including process formation of peripheral neuronal axons. In the early stages of CMT2, demyelination that occurs in Schwann cells (glial cells) is rarely observed. CMT2W is an autosomal-dominant disease and is responsi
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial aminoacyl-tRNA synthetases (mtARSs) are essential in the process of transferring genetic information from mitochondrial DNA to the complexes of the oxidative phosphorylation system. These synthetases perform an integral step in the initiation of mitochondrial protein synthesis by charging tRNAs with their cognate amino acids. All mtARSs are encoded by nuclear genes, nine of which have recently been described as disease genes for mitochondrial disorders. Unexpectedly, the clinical presentations of these diseases are highly specific to the affected synthetase. Encephalopathy is the
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
tRNALys3 is the primer for HIV-1 reverse transcriptase (RI) and is selectively incorporated into HIV-1 during viral assembly. While whole cell extracts of uninfected or infected cells contain only one detectable form of tRNALys3, multiple forms of tRNALys3 are detected in the virus released into the cell culture media. These tRNALys3 isoacceptors are found in HIV-1 produced from newly infected cord blood lymphocytes and from cells chronically infected with HIV-1, such as the lymphocytic cell line H9 and the monocytic cell lines U937 and PLB. They can be detected through the use of either RPC-5
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondria are eukaryotic organelles that generate most of the energy in the cell by oxidative phosphorylation (OXPHOS). Each mitochondrion contains multiple copies of a closed circular double-stranded DNA genome (mtDNA). Human (mammalian) mtDNA encodes 13 essential subunits of the inner membrane complex responsible for OXPHOS. These mRNAs are translated by the mitochondrial protein synthesis machinery, which uses the 22 species of mitochondrial tRNAs (mt tRNAs) encoded by mtDNA. The unique structural features of mt tRNAs distinguish them from cytoplasmic tRNAs bearing the canonical cloverle
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The temperature dependence of processing of precursor tRNA(Gly) (ptRNA(Gly)) variants carrying a single 2'-OCH(3) or locked nucleic acid (LNA) modification at G+1 by Escherichia coli endoribonuclease P RNA was studied at rate-limiting chemistry. We show, for the first time, that these ribose modifications at nucleotide +1 increase the activation energy and alter the activation parameters for the transition state of hydrolysis at the canonical (c(0)) cleavage site (between nucleotides -1 and +1). The modified substrates, particularly the one with LNA at G+1, caused an increase in the activation
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Asparaginyl-tRNA synthetase (NRS) is not only essential in protein translation but also associated with autoimmune diseases. Particularly, patients with antibodies that recognize NRS often develop interstitial lung disease (ILD). However, the underlying mechanism of how NRS is recognized by immune cells and provokes inflammatory responses is not well-understood. Here, we found that the crystal structure of the unique N-terminal extension domain of human NRS (named as UNE-N, where -N denotes NRS) resembles that of the chemotactic N-terminal domain of NRS from a filarial nematode, Brugia malayi,
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: Antisynthetase syndrome (ASS) is characterized by autoantibodies to aminoacyl-tRNA synthetases (anti-synthetase) and it is frequently associated with interstitial lung disease. The purpose of this study was to elucidate the prevalence and characteristics of the anti-synthetase positive subpopulation among idiopathic interstitial pneumonias (IIPs) and to clarify the importance of screening for these antibodies.
METHODS: A retrospective study was performed in 198 consecutive cases with IIPs. Screening for six anti-synthetase antibodies was performed in all cases. Clinical profiles o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
N-Formylation of the Met-tRNAMet by the nuclearly encoded mitochondrial methionyl-tRNA formyltransferase (MTFMT) has been found to be a key determinant of protein synthesis initiation in mitochondria. In humans, mutations in the MTFMT gene result in Leigh syndrome, a progressive and severe neurometabolic disorder. However, the absolute requirement of formylation of Met-tRNAMet for protein synthesis in mammalian mitochondria is still debated. Here, we generated a Mtfmt-KO mouse fibroblast cell line and demonstrated that N-formylation of the first methionine via fMet-tRNAMet by MTFMT is not an a
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aminoacyl-tRNA synthetases (ARSs) catalyze the attachment of specific amino acids to cognate tRNAs for use in protein synthesis. This historical function of ARSs and tRNAs is fairly well understood. However, ARSs and tRNAs also perform noncanonical functions that are continuing to be unveiled at a rapid pace. The expanded functions of these essential molecules of life range from roles in retroviral replication to stimulation of mammalian target of rapamycin (mTOR) activity; DNA repair, splicing, and transcriptional and translational regulation; and other aspects of cellular homeostasis. Furthe
Introductory Journal ArticleПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The existence of two active siter per molecule of L-phenylalanine:tRNA ligase from Escherichia coli K(-10) has been demonstrated by isolation of the E-aminoacyl adenylate and tel filtration and the nitrocellulose filter assay at pH 5.0 revealed the same stoichiometry for the E-tRNAPhe comples as protection against degradation by snake venom phosphodiesterase and equilibrium gel filtration at pH 7.5. Using a fluorescence titration technique, it was found that the dissociation constant for ligase-tRNAPhe complex is decreased 20-fold when the hydrogen ion concentration is changed from pH 6.0 to p
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Listeria monocytogenes is a pathogen that causes listeriosis, a severe food-borne infection. This bacterium, in order to survive and grow in the multiple conditions encountered in the host and the environment, has evolved a large number of regulatory elements, in particular many signal transduction systems based on reversible phosphorylation. The genome sequence has revealed genes for 16 putative two-component systems, four putative tyrosine phosphatases, three putative serine-threonine kinases and two putative serine-threonine phosphatases. We found that one of the latter genes, stp, encodes
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70%
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report seven unrelated families with mitochondrial tRNA(Ser(UCN)) gene mutations at three different loci. A novel G7497A mutation is found in two families, both of which present with progressive myopathy, ragged-red fibers, lactic acidosis, and deficiency of respiratory chain complexes I and IV. This mutation presumably affects the tertiary tRNA(Ser(UCN)) dihydrouridine interaction. Mutations 7472 insC and T7512C, found in three and two families, respectively, are associated with myoclonus epilepsy, deafness, ataxia, cognitive impairment, and complex IV deficiency. No ragged-red fibers or u
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The post-ribosomal fraction of chick duodenal mucosa contains Met-tRNAMetf-binding protein(s) that behaves like the eukaryotic initiation factor (eIF-2) in protein synthesis. The binding activity of cytosol protein can be measured by retention of the radioactive complex formed on a nitrocellulose membrane. Complex-formation requires Met-tRNAMetf and GTP or guanosine [beta, gamma-methylene] triphosphate, and is inhibited by aurintricarboxylic acid. The ternary initiation complex thus formed can bind to ribosomal particles from chick intestine. By sucrose-density-gradient centrifugation, [35S]Me
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mutations in mitochondrial (mt) genes coding for mt-tRNAs are responsible for a range of syndromes, for which no effective treatment is available. We recently showed that the carboxy-terminal domain (Cterm) of human mt-leucyl tRNA synthetase rescues the pathologic phenotype associated either with the m.3243A>G mutation in mt-tRNA(Leu(UUR)) or with mutations in the mt-tRNA(Ile), both of which are aminoacylated by Class I mt-aminoacyl-tRNA synthetases (mt-aaRSs). Here we show, by using the human transmitochondrial cybrid model, that the Cterm is also able to improve the phenotype caused by the m
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования