Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
299 публикаций
Поиск: 396 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 26 с найденным полным текстом
UNLABELLED: Mitochondrial gene mutations have been reported to be associated with sperm motility and the quality of semen. The aim of this study was to investigate whether the two mitochondrial genes (MT-ND4 and MT-TL1) are involved in Chinese male infertility. A total of 97 asthenospermia patients and 80 fertile controls were recruited in this case-control study. Genomic DNA were extracted from the sperm of all participants. Two mitochondrial DNA genes (MT-ND4 and MT-TL1) were amplified by using polymerase chain reaction (PCR) with the gene-specific primers and sequenced on an ABI 3730XL DNA
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Glycyl-tRNA synthetase, a class II aminoacyl-tRNA synthetase, catalyzes the synthesis of glycyl-tRNA, which is required to insert glycine into proteins. In a side reaction the enzyme also synthesizes dinuceloside polyphosphates, which probably participate in regulation of cell functions. Glycine is the smallest amino acid occurring in natural proteins, probably established as a protein component very early in evolution. Besides the amino and the carboxyl groups there is no functional group in the molecule. Alanine, the amino acid which is structurally most similar to glycine, possesses an addi
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Queuosine (Q nucleoside) is a highly modified guanosine analog and is present only in the first position of the anticodons of tRNA(Tyr), tRNA(His), tRNA(Asn) and tRNA(Asp). The levels of Q in normal human brain and two different types of human brain tumors (meningiomas and astrocytomas) were determined by using an enzymatic assay method. tRNAs isolated from tumor tissues contained decrease amounts of Q when compared to tRNAs from normal (i.e. non-tumor) brain tissue. There was a relationship between the levels of Q nucleoside and the tumor malignancy in the sense that the deficiency was greate
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70%
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A novel mutation in the anticodon stem of E. coli tRNA1Tyrsu3+ (G43 to U43) has been characterized. The gene coding for the mutant tRNA, carried by phage phi 80DHA61.3 a derivative of phi 80psu3+su0, produces only 20% of mature suppressor tRNA as compared with phi 80psu3+. Both the mutant tRNA precursor and mature tRNA have an altered conformation. The precursor tRNA coded for by phi 80DHA61.3 is processed by RNase P more slowly than the su3+ precursor and does not form as stable an enzyme-substrate complex as does su3+ precursor. phi 80 DHA61.3 also contains a large deletion which begins in t
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Borrelia burgdorferi and other spirochetes contain a class I lysyl-tRNA synthetase (LysRS), in contrast to most eubacteria that have a canonical class II LysRS. We analyzed tRNA(Lys) recognition by B. burgdorferi LysRS, using two complementary approaches. First, the nucleotides of B. burgdorferi tRNA(Lys) in contact with B. burgdorferi LysRS were determined by enzymatic footprinting experiments. Second, the kinetic parameters for a series of variants of the B. burgdorferi tRNA(Lys) were then determined during aminoacylation by B. burgdorferi LysRS. The identity elements were found to be mostly
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A threonine tRNA was purified from Bacillus subtilis W168 by a combined use of column chromatographic systems. The nucleotide sequence was determined to be pG-C-C-G-G-U-G-U-A-G-C-U-C-A-A-U-D-G-G-D(U)-A-G-A-G-C-A-A-C-U-G-A-C-U-mo5U-G-U-t6A-A-psi-C-A-G-U-A-G-m7G-U-U-G-G-G-G-G-T-psi-C-A-A-G-U-C-C-U-C-U-U-G-C-C-G-G-C-A-C-C-AOH, where about 40 % of D20 remained unmodified as U20. It consists of 76 nucleotides including a new minor nucleoside, 5-methoxyuridine (mo5U), which occupies the wobble position of anticodon.
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial DNA mutations that cause mitochondrial dysfunction are responsible for a wide spectrum of human diseases, referred to as mitochondrial diseases. Pathogenic point mutations are found frequently in genes encoding mitochondrial (mt) tRNAs, indicating that impaired functioning of mutant mt tRNAs is the primary cause of mitochondrial dysfunction. Our previous studies revealed the absence of posttranscriptional taurine modification at the anticodon wobble uridine in mutant mt tRNAs isolated from cells derived from patients with two major classes of mitochondrial diseases, MELAS (mitoch
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe a young woman with a progressive mitochondrial myopathy that started with muscle weakness and went on to include deafness, dementia and ataxia. Skeletal muscle showed the histological and biochemical features of mitochondrial respiratory chain dysfunction. Genetic analysis identified a novel, heteroplasmic, A to G transition in tRNA(Ser(UCN)) at position 7480 affecting a highly conserved base in the anticodon loop. Single-fibre PCR showed highest levels of mutation in cytochrome c-oxidase-deficient fibres and quantification in two biopsies taken 5 years apart showed no change in pe
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report a new mutation, a T-->C transition at nt.4285 in the mitochondrial tRNA(Ile) gene, in a sporadic case of progressive external ophtalmoplegia (PEO) and ragged-red fibers (RRF). The mutation, involving a highly conserved base-pair in the anticodon stem, was detected in high percentages (91%) in muscle, but not in blood. It has never been reported in literature in normal subjects and it was not found in any of 80 controls studied in our laboratory. The absence of the mutation in leukocytes in this case with pure muscle involvement confirms the importance of performing mtDNA studies in P
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The essential deamination of adenosine A34 to inosine at the wobble base is the individual tRNA modification with the greatest effects on mRNA decoding, empowering a single tRNA to translate three different codons. To date, many aspects of how eukaryotic deaminases specifically select their multiple substrates remain unclear. Here, using cryo-EM, we present the structure of a eukaryotic ADAT2/3 deaminase bound to a full-length tRNA, revealing that the enzyme distorts the anticodon loop, but in contrast to the bacterial enzymes, selects its substrate via sequence-independent contacts of eukaryo
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aminoglycoside antibiotics (AA) are drugs with a narrow therapeutic window and cause severe and often irreversible side effects. They are often used in combination with other antibiotics to treat serious infections caused by aerobic Gram-negative rods. Irreversibly combined with rRNA (16S) subunit of the bacterial 30S ribosomal aminoacyl acceptor site interaction disrupting codon (mRNA) of the anticodon (in tRNA). For the bactericidal effect of AA correspond mainly oxygen free radicals, the concentration of drug in serum and post-antibiotic effect. Studies show that the C max./MIC > 8-12 are a
Редакционная статьяАннотация на английскомОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During normal translation, the binding of a release factor to one of the three stop codons (UGA, UAA or UAG) results in the termination of protein synthesis. However, modification of the initial uridine to a pseudouridine (Ψ) allows efficient recognition and read-through of these stop codons by a transfer RNA (tRNA), although it requires the formation of two normally forbidden purine-purine base pairs. Here we determined the crystal structure at 3.1 Å resolution of the 30S ribosomal subunit in complex with the anticodon stem loop of tRNA(Ser) bound to the ΨAG stop codon in the A site. The ΨA b
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Upon release from the stable complex formed with its antitoxin VapB, the toxin VapC (MvpT) of the Gram-negative pathogen Shigella flexneri is capable of globally down-regulating translation by specifically cleaving initiator tRNA(fMet) in the anticodon region. Recombinant Shigella flexneri VapC(D7A) harbouring an active-site mutation was overexpressed in Escherichia coli, purified to homogeneity and crystallized by the vapour-diffusion technique. A preliminary X-ray crystallographic analysis shows that the crystals diffracted to at least 1.9 Å resolution at a synchrotron X-ray source and belon
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial encephalopathy, lactic acidosis and strokelike episodes (MELAS) syndrome is a mitochondrial disorder characterized by a wide variety of clinical presentations and a multisystemic organ involvement. In this study, we report a Tunisian girl with clinical features of MELAS syndrome who was negative for the common m.3243A>G mutation, but also for the reported mitochondrial DNA (mtDNA) mutations and deletions. Screening of the entire mtDNA genome showed several known mitochondrial variants besides to a novel transition m.1640A>G affecting a wobble adenine in the anticodon stem region
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Point mutations in mitochondrial tRNA genes are responsible for individual subgroups of mitochondrial encephalomyopathies. We have recently reported that point mutations in the tRNA(Leu)(UUR) and tRNA(Lys) genes cause a defect in the normal modification at the first nucleotide of the anticodon. As part of a systematic analysis of pathogenic mutant mitochondrial tRNAs, we purified tRNA(Ile) with a point mutation at nucleotide 4269 to determine its nucleotide sequence, including modified nucleotides. We found that, instead of causing a defect in the post-transcriptional modification, a pathogeni
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Uracil at position 34 of transfer RNAs (tRNAs) is generally modified and can recognize G + 3 via two geometrically different pairs, anionic or tautomeric. We sequentially calculated the thermodynamic parameters of isolated U•G pairs in geometrically different states modified with s2U, mnm5U, mcm5U, mnm5s2U, and mcm5s2U, and found that the modifications differently influence their state transition energy (isomerization) and base pairing strength, thereby their formation. Both mnm5U•G and mnm5s2U•G pairs occur as the anionic or tautomeric form and the zwitterionic state is preferred. When tautom
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Derivatives of 5-hydroxyuridine (ho5U), such as 5-methoxyuridine (mo5U) and 5-oxyacetyluridine (cmo5U), are ubiquitous modifications of the wobble position of bacterial tRNA that are believed to enhance translational fidelity by the ribosome. In gram-negative bacteria, the last step in the biosynthesis of cmo5U from ho5U involves the unique metabolite carboxy S-adenosylmethionine (Cx-SAM) and the carboxymethyl transferase CmoB. However, the equivalent position in the tRNA of Gram-positive bacteria is instead mo5U, where the methyl group is derived from SAM and installed by an unknown methyltra
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.