Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
3418 публикаций
Поиск: 408 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 87 с найденным полным текстом
Strongyloidiasis is a major soil-transmitted helminth (STH) disease that affects people worldwide. We present updated data on prevalence in the Lao People's Democratic Republic (Lao PDR) in 2015, arising from a community cross-sectional helminthiasis survey. Fecal samples were collected from 327 individuals across three provinces in Lao PDR (Luang Prabang in the north, Khammouane in the center, and Champasack in the south). Agar plate culture and Kato-Katz methods were used to examine duplicate stool samples from each participant to detect Strongyloides stercoralis and co-infecting helminths.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The J and S isolates of Trichuris muris have different infection profiles in C57BL/6 mice; J worms are expelled, S worms survive to chronicity. Building on this, the ability of the J and S isolates to survive, and the quality of the immune response induced was explored in three different strains of mouse. The resistant BALB/c mouse mounted a strong Th2 response against both isolates, which were quickly expelled. The susceptible AKR host mounted a Th1 response and retained both isolates. Despite equivalent worm exposure, mesenteric lymph node cells from AKR mice infected with the S isolate prod
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite its extensive presence among grazing ruminants, dicrocoeliosis, also known as 'small liver fluke' disease, is poorly known and often underestimated by researchers and practitioners in many countries. The accurate identification and prepatent diagnosis of Dicrocoelium dendriticum infection is an essential prerequisite for its prevention and control. In the present study, the morphologically identified specimens isolated from the bile ducts of sheep (Ovis aries) were validated through molecular data. The sequence analysis of the second internal transcribed spacer (ITS-2) of our isolates
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The development of control strategies for loiasis is of crucial importance in endemic areas and depends heavily on the accurate identification of occult-infected individuals. A polymerase chain reaction (PCR) and nested polymerase chain reaction (nested PCR) were developed and based on sequences of the repeat 3 region (15r3) of the gene encoding a Loa loa 15-kD protein. The assays was performed on 20 blood samples from occult-infected subjects and 30 from field-collected amicrofilaremic individuals. The size of the initial PCR product was 396 basepairs (bp). When this initial amplification usi
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degr
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bacillus Calmette-Guérin (BCG), a live attenuated strain derived from an isolate of Mycobacterium bovis, is one of the childhood vaccinations widely used against tuberculosis (TB). In addition to its effects on mycobacterial diseases, the information has shown the protection effect of BCG in helminthic diseases. In the current review, the role of BCG vaccine in non-specific protection helminthic infection is reviewed. In human alveolar echinococcosis (AE), treatment with BCG enhances host's innate immune response against the parasite via the number and activation of monocytes. In cysticercosis
ОбзорСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Soil-transmitted helminths (STHs) and mutualistic gut microbes coexist in the gastrointestinal tract. However, limited data exist regarding how STH infections are associated with gut microbiome profiles.
METHOD: We conducted a cross-sectional analysis of baseline data collected in a longitudinal study to identify and explain differences in microbial communities between STH-infected and non-infected Ethiopian school children. We collected 138 stool samples and analyzed them for STH infection using standard direct wet mount and Kato Katz methods. The gut microbiome profiles were cha
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Protozoa, helminths and ectoparasites are the major groups of parasites distributed worldwide. Currently, these parasites are treated with chemotherapeutic antiprotozoal drugs, anti-helminthic and anti-ectoparasitic agents, but, with the passage of time, resistance to these drugs has developed due to overuse. In this scenario, nanoparticles are proving to be a major breakthrough in the treatment and control of parasitic diseases. In the last decade, there has been enormous development in the field of nanomedicine for parasitic control. Gold and silver nanoparticles have shown promising results
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Members of the Brachycladiidae are known to cause pathologies implicated in cetacean strandings and it is important to develop accurate diagnostic markers to differentiate these and other helminths found in cetaceans. Brachycladium goliath (van Beneden, 1858) is a large trematode found, as adults, usually in the hepatic (bile) and pancreatic ducts of various cetaceans. Complete sequences were determined for the entire mitochondrial genome, and phylogenetically informative nuclear genes contained within the ribosomal operon, from a small piece of an individual worm taken from a common minke wha
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hysterothylacium aduncum is one of six pathogens responsible for human anisakiasis. Infection with H. aduncum can cause acute abdominal symptoms and allergic reactions and is prone to misdiagnosis in clinical practice. This study aims to enhance the efficiency and accuracy of detecting H. aduncum in food ingredients. We targeted the internal transcribed spacer 1 (ITS 1) regions of Anisakis to develop a visual screening method for detecting H. aduncum using recombinase polymerase amplification (RPA) combined with the CRISPR/Cas12a system. By comparing the ITS 1 region sequences of eight nematod
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The nematode Anisakis simplex is a representative parasite infecting marine animals. When third stage larvae of A. simplex infecting fish and squids are ingested by humans, individuals previously sensitized by this parasite may experience IgE-mediated allergic reactions. So far, as many as 13 kinds of proteins (Ani s 1-13) have been identified as A. simplex allergens but several more unknown allergens are suggested to exist. In this study, therefore, chemiluminescent immunoscreening of an expression cDNA library constructed from the third stage larvae was conducted to identify a new allergen.
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This article summarizes the most recent advances in techniques and applications for the detection of taeniid cestode-infected persons or animals. In addition, the use of molecular approaches for strain identification and control of parasite transmission is discussed.
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: In Cambodia, a limited number of focal surveys targeting dogs in rural communities have reported intestinal helminths of potential zoonotic risk as highly endemic. In this study, we investigated the prevalence, diversity, distribution, and risk predictors associated with zoonotic intestinal helminths infecting pet, community, and pagoda dogs across rural and urban settings in Cambodia through an integrated coproscopic and molecular approach.
METHODS: Faecal samples, demographic, and clinical data were collected from 457 dogs across Cambodia. Faeces were screened for gastroenteri
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The present study aims to describe a new genus and species of microphalloid digenean parasite of two species of bats of the genus Peropteryx from the Mexican Neotropics (in the states of Chiapas and Yucatán). Morphological and molecular data (28s rDNA ribosomal gene sequences) were used to study Digeneans. Sagittatrema zutzi gen. nov. sp., nov., is diagnosed morphologically by having a sagittiform body, a genital pore in the midline of the body, posterior to the ventral sucker, and a cirrus sac running through much of the diameter of the ventral sucker. The nine sequences generated from the 28
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Changes in blood leucocyte levels were investigated in Spraque-Dowley rats vaccinated with cDNA or protein of glutathione S-transferase (GST) of F. hepatica and subsequently challenged with metacercariae of the liver fluke. The analysis of the leucocyte responses measured in vaccinated rats suggests that the form of antigen used for vaccination influenced dynamics of white blood cell response to the fluke infection. The most clear differences were observed in neutrophil and eosinophil levels. The weakest reaction of these cells to the challenge infection was observed in rats vaccinated twice w
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Filarial parasites release macromolecules into their environment both in vitro and in vivo. These excretory-secretory products (E-S) have been studied with respect to function, vaccination potential, pathogenicity, and ability to serve as antigen targets for diagnostic tests. We have recently described monoclonal antibody OV-1 which binds to an intermediate filament in E-S and circulating antigens of Onchocerca volvulus. OV-1 also binds to cross-reactive antigens of Brugia malayi. Therefore, OV-1 was used to immunoscreen a B. malayi adult worm cDNA library in an attempt to clone a homologue (B
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Among the helminths infecting ruminants in China are three taxa belonging to the genus Fasciola: F. hepatica, F. gigantica and the so-called 'intermediate form' that appears to lie between these two species. Based on the sequences of the second internal-transcribed spacers (ITS-2) within the parasites' nuclear ribosomal DNA (rDNA), a pair of primers (DSJf/DSJ3) specific for F. hepatica and a pair (DSJf/DSJ4) specific for F. gigantica were designed and used to develop PCR-based assays. These assays allowed the identification and differentiation of F. hepatica, F. gigantica and the 'intermediate
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sheep were immunized with a protective recombinant antigen (45W) from the cestode parasite Taenia ovis using three different vaccine delivery systems, either alone or in different combinations. The DNA encoding 45W was cloned into the expression plasmid pcDNA 3 and an ovine adenovirus to create nucleic acid and recombinant viral vector vaccines, respectively. Sheep received two vaccinations with various combinations of these two delivery systems and/or purified recombinant 45W protein in a conventional vaccine formulation containing Quil A as adjuvant (protein/Quil A vaccine). Sheep receiving
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: We recently reported the biochemical characterization of a novel Fasciola hepatica recombinant antigen termed FhSAP2, which has previously shown to elicit protection to F. hepatica infection in rabbits. Further we reported that intramuscular (IM) injections of BALB/c mice with a pFLAG-CMV(-2) vector carrying cDNA encoding for FhSAP2 (cDNA-FhSAP2) induce high levels of immune response. The aim of the present study is to ascertain whether the immune response induced by this DNA construct may induce protection in mice against subsequent infection with F. hepatica metacercariae (mc).
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human neurocysticercosis (NC) is caused by Taenia solium larvae lodged in the central nervous system. This disease is usually diagnosed by radiology but the results are not always clear-cut and so immunological assays are often also used. A semi-nested PCR, based on the non-coding HDP2 sequence of T. saginata, has now been developed for detecting DNA from T. solium cysticerci and confirming NC. This PCR, which amplifies a 171-bp T. solium product, allowed the specific detection of just 174 attograms of T. solium DNA. The efficacy of the PCR was tested using cerebrospinal fluid (CSF) from neuro
СтатьяМногоцентровое исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.