Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
7647 публикаций
Поиск: 168 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 750 с найденным полным текстом
Nine oligopeptides corresponding to segments of different open reading frame (ORF) proteins of human papillomavirus (HPV) 6b and HPV-16 were prepared and tested for reactivity with human sera in enzyme-immunoassay (ELISA). Of these only heptadecapeptide derived from L2 ORF of HPV-6b, and encoded also by L2 ORF of HPV 11, was reactive with some human sera. Over 400 human sera of different origin were tested for the presence of antibody to this antigen. While less than 15% of sera from healthy subjects or cervical carcinoma patients were found antibody positive, sera from the majority of condylo
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human papillomavirus (HPV) type 6b genome contains two large open reading frames (ORFs), designated L1 and L2, in a putative late region. These ORFs are expected to code for viral structural proteins. To examine antigenic properties of a L2 gene product, we constructed two plasmids which contain N-terminal (L2-N) and internal (L2-I) regions of the HPV6b L2 ORF and then each region was expressed in Escherichia coli as a fusion protein with E. coli beta-galactosidase (beta-Gal). Both L2-N/beta-Gal fusion proteins reacted with anti-beta-Gal antibody, but did not react with the antibody prepared a
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The 288-nucleotide (nt) 3' untranslated region (UTR) in the genome of the bovine coronavirus (BCoV) and 339-nt 3' UTR in the severe acute respiratory syndrome (SARS) coronavirus (SCoV) can each replace the 301-nt 3' UTR in the mouse hepatitis coronavirus (MHV) for virus replication, thus demonstrating common 3' cis-replication signals. Here, we show that replacing the 209-nt MHV 5' UTR with the ∼63%-sequence-identical 210-nt BCoV 5' UTR by reverse genetics does not yield viable virus, suggesting 5' end signals are more stringent or possibly are not strictly 5' UTR confined. To identify potenti
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several cDNA clones containing the Epstein-Barr virus BamHI fragment H rightward open reading frame 1 (BHRF1) have been recovered from the tightly latent lymphoblastoid cell line IB4. These clones contain the 5' leader exons encoded in the major internal repeat 1 and the viral BamHI fragment Y, identified in the rightwardly transcribed viral mRNAs associated with the latent viral life cycle. In addition, a cDNA clone containing BHRF1 from the Burkitt lymphoma cell line Jijoye was also recovered and exhibits a distinctive splicing pattern. In vitro transcription and translation of BHRF1, follow
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hepatitis E virus (HEV) is a major cause of acute hepatitis in humans, and strains of genotypes 1 and 2 are endemic in many regions with suboptimal sanitary conditions. In many industrialized countries, HEV strains of genotype 3 are highly endemic in swine, and an increased number of autochthonous infections with HEV genotype 3 strains have been reported lately. Serological studies of HEV infection are often conducted with commercial assays based on peptides and recombinant proteins of HEV genotype 1 and 2 strains. For some patients with proven HEV genotype 3 infections, these assays failed to
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The presence of one of the anthrax virulence plasmid pXO1 conserved fragments was analyzed in 24 Bacillus cereus and B. thuringiensis strains, including 6 B. thuringiensis subspecies, by polymerase chain reactions. Twelve out of 24 strains showed PCR-positive for an ORF101 homologous sequence. Two pXO1-ORF101-like fragments from a B. cereus B-4ac and a commercial B. thuringiensis kurstaki HD1 were cloned, sequenced and expressed in Escherichia coli. Toxicity assays revealed that the product encoded by the pXO1-ORF101-like fragment had no impact on either Vero cells or Chinese Hamster Ovary cel
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human T-cell lymphotropic virus type 1 (HTLV-1) causes adult T-cell leukemia/lymphoma and exhibits high genetic stability in vivo. HTLV-1 contains four open reading frames (ORFs) in its pX region. ORF II encodes two proteins, p30(II) and p13(II), both of which are incompletely characterized. p30(II) localizes to the nucleus or nucleolus and has distant homology to the transcription factors Oct-1, Pit-1, and POU-M1. In vitro studies have demonstrated that at low concentrations, p30(II) differentially regulates cellular and viral promoters through an interaction with CREB binding protein/p300. T
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prion disorders are fatal infectious diseases that are caused by a buildup of pathogenic prion protein (PrPSc) in susceptible mammals. According to new findings, the shadow of prion protein (Sho) encoded by the shadow of prion protein gene (SPRN) is associated with prion protein (PrP), promoting the progression of prion diseases. Although genetic polymorphisms in SPRN are associated with susceptibility to several prion diseases, genetic polymorphisms in the rabbit SPRN gene have not been investigated in depth. We discovered two novel single nucleotide polymorphisms (SNPs) in the leporine SPRN
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hepatitis E virus (HEV), a member of the family Hepeviridae, causes both acute and chronic viral hepatitis. We have previously demonstrated that the stem-loop structure in the junction region (JR) of HEV genome plays a critical role in HEV replication. However, the function of the sequence bordering the JR, including the 3' terminus of open reading frame (ORF1), in HEV replication is unknown. In this study, a panel of HEV Renilla luciferase (Rluc) replicons containing various deletions at 5' or 3' termini of the JR was constructed to determine the effect of the deletions on HEV replication in
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The objective of this study was to compare the protection against challenge with porcine circovirus 2 (PCV2) induced by an experimental vaccine based on open reading frame (ORF) 2 of PCV2 DNA plus an adjuvant (aluminum hydroxide, cobalt oxide, or liposome) and a commercial PCV2 subunit vaccine. A total of 35 colostrum-fed, cross-bred, conventional piglets were randomly divided into 7 groups. The commercial vaccine was more efficacious against PCV2 challenge than the 4 experimental vaccines according to immunologic, virologic, and pathological outcomes. The pigs inoculated with the experimental
СтатьяРандомизированное исследованиеПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Gliomas account for the most frequent malignant neoplasms in the central nervous system (CNS). Though there have been developments in therapeutic approaches, the survival rate for most patients remains poor. This research aimed to explore the clinical importance and underlying mechanism of the atypical kinase right open reading frame kinase 1 (RIOK1) in the growth and proliferation of gliomas.
METHODS: Differential expression analysis and survival analysis were assessed in public glioma datasets. The levels of RIOK1 protein expression in glioma tissues and non-tumor brain tissues
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Herpesvirus saimiri (HVS) is an oncogenic, lymphotropic, gamma-herpesvirus that transforms human and simian T cells in vitro and causes lymphomas and leukemias in various species of New World primates. Nucleotide sequence analysis of the HVS genome revealed an open reading frame with 22% amino acid identity to the mouse mammary tumor virus 7 superantigen. In this study, we demonstrate that this open reading frame, HVS14, encodes a heavily glycosylated protein that is secreted. Both the HVS14 present in the supernatant of transfected cells and a chimeric HVS14.Fc fusion protein were found to bi
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Following the identification of mutations in the beta-amyloid precursor protein (APP) gene in familial, early onset Alzheimer's disease (AD), we have developed a screening protocol using single strand conformation analysis (SSCA) to screen exon 17 for the known mutations within APP. In addition, we used this protocol to screen the other seventeen exons of APP and a three hundred and thirty base pair regulatory region of the promoter for new mutations in 9 families with early onset AD. Exons 16 and 17, which encode the deposited beta-amyloid peptide, were screened in a further 10 families. Our
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Deletions in the 3' end region of the hepatitis B virus (HBV) X open reading frame (HBX) may affect the core promoter (Cp) and have been frequently associated with hepatocellular carcinoma (HCC). The aim of this study was to investigate the presence of variants with deletions and/or insertions (Indels) in this region in the quasispecies of 50 chronic hepatitis B (CHB) patients without HCC. We identified 103 different Indels in 47 (94%) patients, in a median of 3.4% of their reads (IQR, 1.3-8.4%), and 25% (IQR, 13.1-40.7%) of unique sequences identified in each quasispecies (haplotypes). Of tho
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The immunogenicity of a DNA vaccine containing an open reading frame (ORF) of genomic island 3 (GI-3), specific for Brucella abortus and Brucella melitensis, has been examined. Intramuscular injection of plasmid DNA carrying the open reading frame with homology to an ABC-type transporter (pV278a) into BALB/c mice elicited both humoral and cellular immune responses. Mice injected with pV278a had a dominant immunoglobulin G2a (IgG2a) response. This DNA vaccine elicited a T-cell-proliferative response and induced significant levels of interferon gamma (INF-γ) upon restimulation with recombinant 2
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dendritic cells (DC) are antigen-presenting cells essential for initiating primary immune responses and therefore an ideal target for viral immune evasion. Varicella-zoster virus (VZV) can productively infect immature human DCs and impair their function as immune effectors by inhibiting their maturation, as evidenced by the expression modulation of functionally important cell surface immune molecules CD80, CD86, CD83, and major histocompatibility complex I. The NF-κB pathway largely regulates the expression of these immune molecules, and therefore we sought to determine whether VZV infection o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Seven human immunodeficiency virus gag polypeptides were identified in the purified virus and in infected CD4+ lymphocytes by peptide mapping and limited amino acid sequencing of immune-purified proteins. Two gag polyproteins of 55,000 (p55) and 41,000 (p41) daltons were rapidly labeled and readily processed into the major internal gag proteins that were aligned within the gag open reading frame (ORF) as NH2-p16 (MA)-p24 (CA)-p9 (NC)-p7-COOH. The myristoylated p16 (matrix, MA) protein was processed from the myristoylated p55 gag precursor protein. The immunoreactivity of the p16 (MA) protein w
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: This study evaluated whether serum levels of mitochondrial open reading frame of the 12S rRNA-c (MOTS-c) could provide prognostic insights in patients newly diagnosed with multiple myeloma (MM), particularly in relation to therapeutic responsiveness.
METHODS: In a prospective analysis involving 29 MM patients, serum MOTS-c concentrations were measured before and after frontline treatment. Associations between MOTS-c fluctuations and clinical-biochemical variables were systematically explored.
RESULTS: Patients who responded to treatment exhibited a substantial post-therapy increa
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Methicillin-resistant Staphylococcus aureus (MRSA) is the most common causative bacteria of hospital acquired infection, and should be rapidly identified for infection control. For this purpose, in our hospital, the PCR electrophoresis patterns of spacer regions (ITS: internal transcribed spacers) (ITS-PCR) are combined with a toxigenicity assay to establish a strain identification method for outbreak surveillance. In the present study, the usefulness of this method was evaluated in comparison with the POT (phage-open reading frame typing) method. One hundred MRSA strains isolated from inpatie
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.