Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
483 публикаций
Поиск: 464 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 227 с найденным полным текстом
Scanning electron (SEM) microscopy of epoxy replicas made from dental impressions has shown that in buccal gingival recession the root surfaces are devoid of cementum, leaving the dentin exposed. In this study replication techniques were applied to correlate the micromorphology of the buccocervical region with early streptococcal attachment. The subjects were 27 healthy young adults. The buccocervical surfaces of all the premolars were meticulously cleaned. The subjects fasted for 2 h before impression-taking. Replicas were made from impressions in hydrophilic A-silicone, and streptococcal att
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
11 volunteer subjects with advanced chronic periodontitis participated in a 1-year longitudinal clinical and microbiological study. Subgingival plaque was collected at each of 7 visits from 148 pre-selected sites in the left jaw quadrants (test sites) and on the first and last visits, only from 117 sites in the left jaw quadrants (control sites). All sites were examined clinically at each of the 7 visits, and the microbiological markers investigated were the % spirochaetes and % black pigmented Bacteroides species in subgingival plaque. At the completion of the study, the sequential changes in
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mobile integrons are the most efficient mechanism of Gram-negative bacteria to resist antimicrobial changing pressures in the nosocomial niche. Integron’s integrases mediate site-specific recombination of distinct DNA structures such as attI, attC and attG sites. Here, we identified novel ΔattI sites as part of 26 unusual ΔattI-type gene cassettes conferring resistance to four different antibiotic families. Since scarce data are found related to their functionality, we investigated site-specific recombination mediated by IntI1 of attI1-aadB-attI1, attI1-aadB-ΔattI1− 11, attCaadA1-aadB-ΔattI2−
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This study was designed to evaluate the clinical and microbiological effects of local administration of 2% minocycline-HCl ointment (Periocline) combined with scaling and root planing in recurrent periodontal pockets. Thirty-three sites were selected for this examination. The sites had probing depths greater than 5 mm and loss of attachment greater than 2 mm within the previous 3 months. They were assigned as test (22 sites) or control sites (11 sites). After meticulous scaling (SC) and root planing (RP), Periocline was delivered into the periodontal pockets of test sites: control sites were i
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of this study was to examine the distribution of typical periodontitis-associated microorganisms in refugees arriving from non-industrialized countries, and to relate the presence of these organisms to the periodontal condition of the subjects. Thirty males between 35-44 years of age were surveyed. Dental plaque, calculus, gingivitis, loss of attachment, and probing depths were recorded for all surfaces. A total of 90 microbiological samples were taken with paper points from mesial sites of teeth 16, 36 and 41. Microbiological test sites were grouped by probing depths and loss of attac
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Extrachromosomal arrays are unique chromosome-like structures created from DNA injected into the Caenorhabditis elegans germline. However, they are unstable unless integrated into a chromosome. Current methods for integration using x-rays or CRISPR can damage DNA and exhibit low efficiency. We demonstrate that the viral integrase PhiC31, which mediates nonmutagenic recombination between short attB and attP sequences, can be used for extremely efficient and targeted integration of arrays. Arrays were integrated by PhIAT (PhiC31-mediated integration of arrays of transgenes) at attB sites on thre
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Gingival crevicular fluid (GCF), reflects the immune and inflammatory reactions and is itself a location for specific host-microbe interactions that lead to periodontal diseases. Aspartate aminotransferase (AST) is one of the components of GCF that is released as a result of cell death. In this study, 40 periodontal sites in 10 early onset periodontitis patients before and after nonsurgical periodontal therapy, with and without local metronidazole administration, were first examined for the AST enzyme levels in GCF and then evaluated for microbiological and clinical variables. In each patient,
Клиническое исследованиеСравнительное исследованиеСтатьяРандомизированное исследованиеПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of the present parallel, double-blind investigation was to evaluate the effect of using systemic metronidazole alone or associated to scaling and root planing on adult chronic periodontal disease, monitored at baseline, 30, 60 and 90 days. Twelve subjects were divided into three groups: the first group (Group I - 22 sites) was submitted to scaling and root planing (SRP) alone; the second group (Group II - 30 sites) received SRP and 250 mg of metronidazole (3 times a day for 10 days), and the third group (Group III - 31 sites) was treated with metronidazole alone. The clinical parameter
Клиническое исследованиеКонтролируемое клиническое исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Localization and semiquantification of beta-haemolytic streptococci, Group A (GABHS), GABHS attachment and general bacterial attachment to epithelial cells (bacterial number and morphology) were studied during GABHS-positive acute tonsillitis and pharyngitis infections and among healthy GABHS carriers. Samples were collected from various areas of the oropharynx (palatine tonsils, posterior oropharyngeal wall, palatoglossal arch and buccal mucosa). During acute tonsillitis and pharyngitis, GABHS grew in samples obtained from the palatine tonsils and posterior oropharyngeal wall. The ratio of GA
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Adjunctive use of professional subgingival irrigation with scaling and root planing (SRP) has been found to be beneficial in eradicating the residual microorganisms in the pocket.
OBJECTIVE: To evaluate the effect of ozonized water subgingival irrigation on microbiologic parameters and clinical parameters namely Gingival index, probing pocket depth, and clinical attachment level.
MATERIALS AND METHODS: Thirty chronic periodontitis patients with probing pocket depth ≥6mm on at least one tooth on contra lateral sides of opposite arches were included in the study. The test sites w
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Clinical, microbiological and immunological factors were examined using data from a subject with periodontosis. The subject was monitored at bimonthly intervals for 26 months at 6 sites per tooth for redness, plaque, suppuration, bleeding on probing, pocket depth, and attachment level. Using attachment level measurements and the tolerance method of analysis, sites with active disease and control (inactive) sites of equal pocket depth were selected. Subgingival plaque samples were taken from these sites for predominant cultivable and dark field evaluation before, and 5 and 13 months after treat
Клинический случайСравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIM: The purpose of this study was to compare the microbiological and clinical effects of antimicrobial photodynamic therapy (aPDT) in treating chronic periodontitis by using indocyanine green (ICG) with an 810 nm diode laser and methylene blue (MB) with a 660 nm diode laser as adjuncts to scaling and root planing (SRP).
MATERIALS AND PROCEDURES: In this split-mouth design research, 14 people were recruited. Three sets of treatment sites were randomly assigned: SRP with aPDT utilizing MB or ICG (test groups) and SRP alone (control group). Using real-time polymerase chain reaction (RT-PCR), sa
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Evaluation of the clinical and microbiological effects of scaling and root planing (SRP) alone or in combination with 0.12% chlorhexidine (CHX) rinsing.
METHODS: A blind, placebo-controlled, parallel-design, randomized clinical trial was conducted in 29 subjects with chronic periodontitis. Subjects were assigned to two therapeutic groups: control (SRP+placebo) and test (SRP+CHX during and up to 42 days post-therapy). Clinical and microbiological [N-benzoyl-dl-arginine-2-naphthylamide (BANA test)] examinations were performed at baseline, 42 and 63 days post-therapy.
RESULTS: Initia
Сравнительное исследованиеСтатьяРандомизированное исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
It has been shown that patients with localized juvenile periodontitis (LJP) often harbor Actinobacillus actinomycetemcomitans in the subgingival area. However, little is known of the oral microflora in non-LJP juvenile periodontitis patients with less extensive disease. The purpose of this study was to describe the microflora and clinical parameters of young adults with minor to moderate periodontitis during treatment for a period of 1 year. Eleven patients 15 to 16 years of age were studied. All of them had 4 to 8 mm loss of attachment at minimally one site, but the typical clinical descripti
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The purpose of the present investigation was to examine the effect of SRP on clinical and microbiological parameters in 57 subjects with adult periodontitis (mean age 47 +/- 11 years). Subjects were monitored clinically and microbiologically prior to and 3, 6 and 9 months after full-mouth SRP under local anaesthesia. Clinical assessments of plaque, redness, suppuration, BOP, pocket depth and attachment level were made at 6 sites per tooth. The means of duplicate attachment level measurements taken at each visit were used to assess change between visits. Clinical data were averaged within each
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The large serine recombinase Bxb1 catalyzes recombination between DNA molecules containing compatible attP and attB sequences, offering broad applications in genome engineering and gene therapies. Here, we present cryo-electron microscopy structures of the Bxb1-attP-attB synaptic complex in four distinct functional states during its recombination cycle. Notably, the Bxb1 complex structures in the pre-, mid-, and post-strand-exchange states explain how the attP- and attB-bound Bxb1 dimers are assembled into a tetrameric synaptic complex and how an approximately 180° rotation occurs between the
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Periodontal disease progression requires the simultaneous presence of high numbers of pathogens, low numbers of compatible or beneficial species, a conducive local environment, and a susceptible host. Effective therapy acts by altering one or more of these factors. Data from an ongoing study were used to examine the biological basis of treatment success or failure. Seventeen subjects showing disease progression were treated by Widman flap surgery at deep sites, scaling at shallow sites, and 1 of 4 randomlyassigned, systemically-administered adjunctive agents including amoxicillin/clavulanate p
Клиническое исследованиеСтатьяРандомизированное исследованиеПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The periodontal pathogen Actinobacillus actinomycetemcomitans can frequently be isolated from subgingival plaque of adults with chronic inflammatory periodontal disease and individuals with plaque-induced gingivitis. Problems with the persistence of the organism after thorough debridement of root surfaces have been reported. In the present study clinical effects of the hygienic phase of periodontal therapy in ten adult patients with moderate or advanced periodontitis harbouring A. actinomycetemcomitans were analysed. Since proper analysis of highly correlated data within a given patient is cru
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A randomized, double-blind, placebo-controlled study on the immediate clinical and microbiological efficacy of doxycycline (100 mg for 14 days) was carried out to determine the benefit of adjunctive medication in 16 patients with localized juvenile periodontitis. Measurements of gingival fluid flow, probing depths, bleeding on probing and suppuration were determined at 2 periodontal sites with and 2 without radiographic attachment loss, at weeks 0, 1, 3 and 8. Subgingival bacterial samples were taken with curettes from the same sites. Spirochaetes were searched for by dark-field microscopy. Ac
Клиническое исследованиеСтатьяРандомизированное исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.