MedElevator
Войти в исследования Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics · 2021
[A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis].
Клинический случайСтатьяНазвание и аннотация: Перевод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Zheng Shuhong, Chen Hairui, Mo Miaojun
Аннотация
OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.