Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Доступно в поиске
34 публикаций
Поиск: 28 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 0 с найденным полным текстом
International journal of surgery case reports2024eng
INTRODUCTION AND IMPORTANCE: Congenital iris and choroidal coloboma is a congenital ocular developmental anomaly, most occur in both eyes, which may exist in isolation or be accompanied by systemic developmental abnormalities. Herein, we report a case of congenital bilateral coloboma of iris and choroid accompanied by unilateral multiple primary pigmented iris cysts. The selection of treatment methods for iris cysts has always been a challenge for ophthalmologists. Especially for primary iris pigment epithelial cysts without clinical symptoms, no particular intervention measures are required.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The objective of this work was to identify phenotypic features and cytogenetic aspects of trisomy 13 in Moroccan population. The retrospective study was conducted on a group of 9 cases diagnosed cytogenetically with trisomy 13. The study of sex ratio showed a slight female dominance in our group of cases. The major clinical findings included: Holoprosencephaly, microphthalmia and anophthalmia, coloboma of iris, cleft lip and palate, nasal and ear abnormalities, retrognathism and sloping forehead, polydactyly, capillary hemangiomas, omphalocele, congenital heart defect, renal abnormalities, cry
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: To measure lamina cribrosa thickness (LCT), lamina cribrosa depth (LCD) and subfoveal choroidal thickness (SFCT) by imaging posterior ocular structures in pediatric cases with isolated unilateral iris coloboma and to investigate the differences as compared with healthy contralateral eyes of these cases (fellow eyes) and healthy control eyes.
METHODS: This cross-sectional, comparative prospective study included seven children (age range, 9-17 years) with unilateral isolated iris coloboma. The healthy contralateral eyes of these cases formed the fellow group. An age-matched (age ran
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Microphthalmia, anophthalmia are the malformations of the eye, referring to a congenital absence, and a reduced size of the eyeball. Coloboma of iris is associated with many of the cases. Here, we report a propositus with eye anomalies and intellectual disability associated with TENM3 pathogenic variations identified by exome sequencing and confirms intellectual disability as a phenotype associated with TENM3 variations. This child was compound heterozygote [NM_001080477.3(TENM3):c.4046C > G; p.(Ala1349Gly) and NM_001080477.3(TENM3): c.7687C > T; p.(Arg2563Trp)] for the missense likely pathoge
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 42-year-old woman was admitted to our clinic with a complaint of glare in both eyes. Biomicroscopic examination of both the eyes revealed iris and lens colobomas in the inferior quadrant. Fundus examination of the right eye revealed an oval and gray inferotemporal optic pit and two choroid colobomas in the inferior quadrant. In the left eye, two choroid colobomas were detected that were inferior to the optic nerve head. Furthermore, a 21-year-old man presented to our clinic for a routine ophthalmologic examination. Bilateral biomicroscopic examination was normal. Fundus examination of the le
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Goltz syndrome or Focal Dermal Hypoplasia is a rare multisystem disorder, involving all the three germ cell layers. The disease is thought to be inherited in X-linked dominant fashion with heterogeneous mutations of the PORCN gene at Xp11.23 locus. Majority of the cases are sporadic, mainly due to postzygotic somatic mutations. The clinical spectrum includes characteristic cutaneous manifestations, multiple skeletal anomalies, and involvement of the eyes, hair, nails, kidneys, and so on. Considerable variability is noted in the clinical expression of the disease probably due to genomic mosaici
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe a preterm neonate with bilateral coloboma of the iris, upper and lower limb malformations including rocker bottom feet, camptodactyly, and clinodactyly together with microcephaly and small for gestational age whom cytogenetic diagnosis using SNP microarray detected an interstitial deletion of chromosome 2 between 2q31.1 and 33.1.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: The paired box gene 6 (PAX6) is an essential transcription factor for eye formation. Genetic alterations in PAX6 can lead to various ocular malformations including aniridia. The purpose of this study was to identify genetic defects as the underlying cause of familial ocular coloboma in a large Chinese family.
METHODS: After linkage analysis was carried out in this family, all exons of PAX6 in the proband were sequenced by the Sanger sequencing technique. Then the genome of the proband was evaluated by a microarray-based comparative genomic hybridization (aCGH). Quantitative real-time
Клиническое исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: Aniridia (AN) is a rare congenital panocular disorder caused by the mutations of the paired box homeotic gene 6(PAX6) gene. The PAX6gene is also involved in other anterior segment malformations including Peters anomaly. We studied the PAX6gene mutations in a cohort of affected individuals with different clinical phenotype including AN, coloboma of iris and choroid, or anterior segment malformations.
PATIENTS AND METHODS: Six unrelated families and 10 sporadic patients were examined clinically. After informed consent was obtained, genomic DNA was extracted from the venous blood of all
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Small supernumerary marker chromosomes are present in about 0.05% of the human population. In approximately 28% of persons with these markers (excluding the approximately 60% derived from one of the acrocentric chromosomes), an abnormal phenotype is observed. We report on a 3-month-old girl with intrauterine growth retardation, craniofacial features, hypotonia, partial coloboma of iris and total anomalous pulmonary venous return. Cytogenetic analysis showed the presence of a supernumerary marker chromosome, identified by fluorescence in situ hybridization as part of chromosome 22, and conferri
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: The choroidal coloboma is a congenital malformation that results from an anomaly of the embryonic fissure. This anomaly is frequently associated to numerous ocular and systemic anomalies, but rarely to familial adenomatous polyposis.
CASE REPORT: We report a 12 years-old boy, who consulted for severe visual impairment of the right eye. The clinical examination revealed a coloboma of the iris and choroid and numerous lesions of congenital hypertrophy of the retinal pigmentary epithelium while exploration of the digestive tract revealed the presence of familial adenomatous polypos
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A new case of severe clinical phenotype of the cat-eye syndrome: We report on a female infant with severe clinical phenotype of Cat-Eye Syndrome (CES). At birth, she had respiratory distress and marked hypotonia. Physical examination showed major craniofacial anomalies including microcephaly, bilateral total absence of the external ears, hypertelorism, bilateral ocular coloboma of iris and micrognathia. In addition, she had anal stenosis, a patent ductus arteriosus and intra- and extra- hepatic biliary atresia. She deteriorated with the development of bradycardia. She died at age one month of
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During embryogenesis, about 40% of genes are involved in the development of the central nervous system (CNS). The same genes support the integrity and function of brain cells in humans. Birth defects cause different changes in genetic material during embryogenesis. They may also be responsible for precocious death of cells in postnatal period. We studied cases of two infants with similar congenital defects (prenatal onset growth deficiency, coloboma of iris, epicanthal folds, low set ears, clinodactyly of Vth fingers). The infants died at age 9 and 10 months with signs and symptoms of progress
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe a female child with a ring chromosome 3, found after investigation for short stature. Her karyotype was 46,XX,r(3)(p26-q29). Her phenotype mainly differs from that of the nine patients previously reported with ring chromosome 3, by the presence of hypoplastic right thumb and bilateral coloboma of the iris.
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To describe the clinical features, laboratory investigation and treatment of Kallmann syndrome.
DESIGN: A retrospective study of patients treated in the Endocrine Clinic of the Royal Children's Hospital and St Vincent's Hospital, Melbourne, between 1984 and 1996.
RESULTS: Eleven males and 5 females with Kallmann syndrome are described. Their ages at presentation ranged from one week to 21 years. Presenting symptoms were micropenis, small testes, anosmia and delayed puberty. Fifty-six percent (9/16) had a family history of either anosmia or infertility. The features of Kallmann syn
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report on a 4-month-old boy with a de novo interstitial deletion of the short arm of chromosome 3 (pter-->p21.2::p12-->qter) and clinical findings typical of proximal 3p deletion together with coloboma of iris, heart defect, choanal atresia, retardation of growth and development, genital hypoplasia, and ear anomalies. Family history was unremarkable and parental chromosomes were normal. The clinical manifestations of the patient are compared with those of 10 patients previously described with a proximal 3p deletion. The additional CHARGE-like phenotype is discussed.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report on a 5-year-old boy with bilateral coloboma of iris, short stature, moderate developmental delay, and a few minor craniofacial anomalies. High-resolution GTG banding showed a small distal deletion of one chromosome 16 [del(16)(q23.1q24.2)]. Molecular refinement of the deletion breakpoints yielded that the proximal breakpoint at 16q23.1 is located between loci D16S395 (present) and D16S348 (absent). Comparison with previously published cases of deletion 16q demonstrated that the clinical phenotype is not a recognizable 16q- syndrome and different from the two cases of deletions of 16(
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report extreme expression of Treacher Collins syndrome in an infant with arhinia, anotia, absent zygomatic bones, hypoplastic mandibular rami, and bilateral coloboma of iris, choroid plexus, and optic nerves. The Treacher Collins phenotype was mildly expressed in the mother and moderately in the sister. The father had no signs and was not ruled out as the father by DNA fingerprinting, thus making homozygosity by descent in the severely affected son very unlikely.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The syndrome: We describe 3 Brazilian brothers presenting a cluster of signs strongly suggesting a "new" MCA/MR syndrome. The main clinical signs include short stature, microbrachycephaly, mental retardation, palpebral ptosis, coloboma of iris and retina, nystagmus, strabismus, and cleft lip/palate. This is either an autosomal or X-linked recessive trait.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.