Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
At least eight inherited human neurodegenerative diseases are caused by expansion of a polyglutamine domain within the respective proteins. This confers dominant toxicity on the proteins, leading to dysfunction and loss of neurons. Expanded polyglutamine proteins form aggregates, including nuclear inclusions (NI), within neurons, possibly due to misfolding of the proteins. NI are ubiquitinated and sequester molecular chaperone proteins and proteasome components, suggesting that disease pathogenesis includes activation of cellular stress pathways to help refold, disaggregate or degrade the muta
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Lumazine synthase from Brucella abortus was overexpressed in Escherichia coli, refolded, and purified to apparent homogeneity. Crystals of lumazine synthase were grown by the hanging drop vapor diffusion method using polyethylene glycol 8000 or ammonium sulfate as precipitants. They belong to the trigonal space group P321 with cell parameters a = b = 132.00A, c = 167.25 A. A complete diffraction data set to 3.7 A resolution has been collected using synchrotron radiation. Preliminary analysis of the quaternary structure of this protein by means of a self-rotation function calculated with the di
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cardiotoxin analogue III (CTX III) isolated from the venom of the Taiwan Cobra (Naja naja atra) is a small molecular weight, all beta-sheet protein, cross-linked by four disulfide bridges. The unfolding and refolding mechanisms of CTX III have been examined by monitoring the reversible conversion of the native and scrambled species. It is found that, in the presence of a denaturant (urea/guanidinium hydrochloride) and a thiol catalyst, CTX III forms a mixture of scrambled species by shuffling its four native disulfide bonds. Complete unfolding of CTX III can be achieved using either 3.0-4.0 M
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
lncRNAs are at the core of many regulatory processes and have also been recognized to be involved in various complex diseases. They affect gene regulation through direct interactions with RNA, DNA or proteins. Accordingly, lncRNA structure is likely to be essential for their regulatory function. Point mutations, which manifest as SNPs (single nucleotide polymorphisms) in genome screens, can substantially alter their function and, subsequently, the expression of their downstream regulated genes. To test the effect of SNPs on structure, we investigated lncRNAs associated with dilated cardiomyopa
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bacterial toxin or viral entry into the cell often requires cell surface binding and endocytosis. The endosomal acidification induces a limited unfolding/refolding and membrane insertion reaction of the soluble toxins or viral proteins into their translocation competent or membrane inserted states. At the molecular level, the specific orientation and immobilization of the pre-transitioned toxin on the cell surface is often an important prerequisite prior to cell entry. We propose that structures of some toxin membrane insertion complexes may be observed through procedures where one rationally
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Porin, from Rhodabacter capsulatus, was chemically modified with methoxypoly(ethylene glycol) (m-PEG; molecular mass = 5000 Da) succinimidyl carbonate to yield methoxypoly(ethylene glycol)-porin (m-PEG-SC-Porin), as previously reported for bacteriorhodopsin [Sirokman, G., & Fasman, G. D. (1993) Protein Sci. 3, 1101-1170]. The m-poly(ethylene glycol)-porin (m-PEG-SC-Porin 50) conjugate, containing one poly(ethylene glycol) chain, was water soluble. The secondary structure of the conjugate in water was mainly random coil. Circular dichroism spectroscopy showed it was predominantly in the beta-pl
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
High temperature requirement A serine peptidase 1 (HTRA1) is a serine protease involved in an array of signaling pathways. It is also responsible for the regulation of protein aggregates via refolding, translocation, and degradation. It has subsequently been found that runaway proteolytic HTRA1 activity plays a role in a variety of diseases, including Age-Related Macular Degeneration (AMD), osteoarthritis, and Rheumatoid Arthritis. Selective inhibition of serine protease HTRA1 therefore offers a promising new strategy for the treatment of these diseases. Herein we disclose structure-activity-r
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A cDNA encoding Bungarus multicinctus (Taiwan banded krait) phospholipase A2 was expressed in Escherichia coli. The expressed PLA2 contained a Met residue fused to the N-terminus of PLA2. The expressed protein was isolated from inclusion bodies of E. coli and subjected to refolding into its folded structure. Then the N-terminus Met residue of recombinant PLA2 was cleaved with aminopeptidase. The resulting recombinant PLA2 had the same amino acid composition and N-terminal sequence of native PLA2 and displayed the same CD spectra and pI value as native enzyme. Moreover, the recombinant PLA2 was
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The cDNA of the human GM2-activator protein was cloned into the expression vector pHX17. The plasmid encodes a fusion protein with a hexahistidine tail and a Factor Xa cleavage site at its N-terminus. The recombinant protein was purified from cell homogenates under denaturing conditions by metal-ion affinity chromatography in a single step and then was refolded. The hexahistidine tail could be removed when desired by digestion with Factor Xa. In a functional assay, the GM2-activator thus generated from Escherichia coli and renatured, with or without the hexahistidine tail, was as active as the
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Laforin is a unique human dual-specificity phosphatase as it contains an amino terminal carbohydrate binding module (CBM). Laforin gene mutations lead to Lafora disease, a progressive myoclonus epilepsy with an early fatal issue. Previous attempts to produce recombinant laforin faced various difficulties, namely the appearance of protein inclusion bodies, the contamination with bacterial proteins and a high tendency of the protein to aggregate, despite the use of fusion tags to improve solubility and ease the purification process. In this work, we have expressed human laforin in Escherichia co
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snake venoms contain a complex mixture of many biological molecules including proteins. The purification of recombinant proteins is a key step in studying their function and structure with affinity chromatography as the common method used in their purification. In bacterial expression systems, hydrophobic recombinant proteins are usually precipitated into inclusion bodies, and contaminants are typically associated with tagged proteins after purification. The purpose of this study was to develop a procedure to purify hydrophobic recombinant proteins without an affinity tag. Snake venom mature C
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Antibody mimics have significant scientific and therapeutic utility for the disruption of protein-protein interactions inside cells; however, their delivery to the cell cytosol remains a major challenge. Here we show that protective antigen (PA), a component of anthrax toxin, efficiently transports commonly used antibody mimics to the cytosol of mammalian cells when conjugated to the N-terminal domain of LF (LFN). In contrast, a cell-penetrating peptide (CPP) was not able to deliver any of these antibody mimics into the cell cytosol. The refolding and binding of a transported tandem monobody t
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The very low affinity of the T-cell receptor (TCR) for the peptide-major histocompatibility complex (pMHC) has made it very challenging to design assays for testing the functionality of these molecules on small scales, which in turn has severely hampered the progress in developing expression and refolding methodologies for the TCR. We have now developed an ELISA assay for detecting pMHC binding to functional recombinant TCRs. It uses tetramers of biotinylated pMHCs bound to a neutravidin-horseradish peroxidase conjugate and detects the presence of functional TCR, bound in a productive orientat
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Conformational changes of proteins can occur due to mutations or stress conditions, altering their functionality through loss of physiological or gain of pathological function. A Protein Quality Control (PQC) system exists in cells to deal with the accumulation of misfolded proteins and aggregates, comprising a network of chaperones and degradative pathways to refold or remove the aberrant proteins. Protein misfolding and PQC system impairment lead to a broad range of diseases, including neurodegenerative and neuromuscular disorders, among them spinal and bulbar muscular atrophy (SBMA). SBMA i
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Японский энцефалит (JEV) является наиболее важной причиной энцефалита в большинстве азиатских регионов. В домене III JEV (JEV EDIII) белок участвует в связывании рецепторов, и он содержит конкретные эпитопы, которые вызывают антитела, нейтрализующие вирусы. Очень иммуногенный, рекомбинированный белок JEV EDIII был выражен в Escherichia coli. Для того чтобы взять этого кандидата на вакцину для дальнейших исследований, был произведен рекомбинантный белок JEV EDIII с использованием экспериментального процесса ферментации. Рекомбинантный белок JEV EDIII, выраженный в виде инклюзивных тел (IBs), бы
СтатьяПоиск полного текста в очередиМашинный перевод · не проверен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Yersinia pestis, the agent of plague, requires the Ail (attachment invasion locus) outer membrane protein to survive in the blood and tissues of its mammalian hosts. Ail is important for both attachment to host cells and for resistance to complement-dependent bacteriolysis. Previous studies have shown that Ail interacts with components of the extracellular matrix, including fibronectin, laminin and heparan sulfate proteoglycans, and with the complement inhibitor C4b-binding protein. Here, we demonstrate that Ail-expressing Y. pestis strains bind vitronectin - a host protein with functions in c
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MPT64, a secreted protein of Mycobacterium tuberculosis (MTB), stimulates the immune reactions within cells and is a protective antigen that is lost by the bacilli Calmette-Guérin (BCG) vaccine during propagation. To minimize the toxicity caused by MTB, we used the MPT64 gene encoded by nontoxic H37Ra MTB to carry out genetic expansion via polymerase chain reaction and gene clone MPT64. The plasmid DNA encoded MPT64 was expressed at 20°C for 22 H, and a large quantity of MPT64 was obtained. In the absence of urea, MPT64 multimers with subunits being covalently connected via disulfide bonds wer
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The amyloid-β peptide (Aβ42) is the main component of the inter-neuronal amyloid plaques characteristic of Alzheimer's disease (AD). The mechanism by which Aβ42 and other amyloid peptides assemble into insoluble neurotoxic deposits is still not completely understood and multiple factors have been reported to trigger their formation. In particular, the presence of endogenous metal ions has been linked to the pathogenesis of AD and other neurodegenerative disorders.
RESULTS: Here we describe a rapid and high-throughput screening method to identify molecules able to modulate amyloid
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Visceral Leishmaniasis (VL) represents an important global health problem in several warm countries around the world. The main targets in this study are the two nucleoside triphosphate diphosphohydrolases (NTPDases) from Leishmania infantum chagasi that are the main etiologic agent of VL in the New World. These enzymes, called LicNTPDase1 and -2, are homologous to members 5 and 6 of the mammalian E-NTPDase/CD39 superfamily of enzymes. These enzymes hydrolyze nucleotides and accordingly can participate in the purine salvage pathways and in the modulation of purinergic signaling through the extr
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования