Protein-chemical and molecular studies were conducted on all osteogenesis imperfecta (OI) type III/IV patients referred to our hospital during the last 15 y. Of a total of 16 OI type III/IV patients studied, 15 patients were heterozygous for a mutation in one of the two genes coding for collagen I, COL1A1 or COL1A2. Cultured fibroblasts from these 15 patients produced both normal and abnormal collagen I molecules, pointing to a dominant-negative effect of the mutation. Nine mutations had not been described previously. Parental mosaicism was demonstrated in three families. In the 16th child the…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In general, osteogenesis imperfecta is caused by heterozygous mutations in either of the genes encoding the alpha 1 or alpha 2 chains of type I collagen (COL1A1 and COL1A2, respectively). Usually, these mutations are unique to the affected individual or individuals within a family. In this study, single-strand conformation polymorphism mapping analysis has been coupled with sequence analysis to identify a single base mutation in the alpha 2(I) gene of type I collagen; this mutation is identical in three unrelated individuals with perinatal lethal osteogenesis imperfecta. The heterozygous G to …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Serum concentrations of procollagen I C-terminal propeptide (PICP) were studied in 74 patients with various forms of non-lethal osteogenesis imperfecta and 27 unaffected family members. Using the standard deviation (SD) score, PICP concentrations were found to be > or = -1 SD in 16%, between -1 and -2 SD in 26% and < or = -2 SD in 58% of the patients with osteogenesis imperfecta compared to healthy controls. PICP values were lowest in osteogenesis imperfecta type I (-2.4 +/- 0.4 SD, n = 37) followed by type III (-1.9 +/- 0.5 SD, n = 13) and type IV (-1.3 +/- 0.7 SD, n = 20). Four patients with…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have identified a point mutation in one alpha 1(I) collagen allele (COL1A1) of a child with the type IV osteogenesis imperfecta phenotype. When compared to parental and control samples, skin fibroblasts of the proband synthesized two populations of type I collagen molecules. One population was normal; the other was delayed in secretion and electrophoretic migration due to post-translational overmodification. Two-dimensional gel electrophoresis of the CNBr peptides demonstrated a gradient of overmodification beginning near the carboxyl-terminal CB peptides. This predicts that the mutation de…
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have examined the collagenous proteins extracted from skin and produced by skin fibroblast cultures from the members of a family with mild dominant osteogenesis imperfecta (OI type I). The two affected patients, mother and son, produce two populations of alpha 1(I) chains of type I collagen, one chain being normal, the other containing a cysteine within the triple-helical domain. Both forms can be incorporated into triple-helical molecules with an alpha 2(I) chain. When two mutant alpha (I) chains are incorporated into the same molecule, a disulfide bonded dimer is produced. We have charact…
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Connective tissue disorders are known to cause cardiac and vascular complications. We present the case of a 37-year-old female patient with a rare Ehlers Danlos/Osteogenesis Imperfecta Overlap Syndrome, referred to cardiac surgery with aortic valve regurgitation, who underwent a successful Biological Surgical Aortic Valve Replacement (SAVR). A multidisciplinary, patient-centered, heart-team approach is essential in managing patients with rare genetic disorders to optimize postoperative outcomes. Adult cardiac surgeons must become familiar with genetic syndromes and their implications for impro…
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Biplanar distraction osteogenesis (DO) is effective for correcting mandibular hypoplasia and asymmetry. However, lateralization of the intermediate segment between the two osteotomy cuts during distraction is a frequent complication that can affect occlusion and facial symmetry. Traditionally managed with invasive surgical correction, this increases morbidity and treatment complexity. We present a non-invasive technique using external orthodontic elastics to correct segment lateralization. A 22-year-old female with bilateral mandibular hypoplasia developed lateralization after biplanar DO. Cor…
СтатьяКлинический случайПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Osteogenesis imperfecta (OI) is a rare hereditary disorder characterized by bone fragility and deformity, frequently requiring surgical intervention to restore limb alignment and stability. Traditional intramedullary fixation devices are limited in growing children. The Fassier-Duval (FD) nail, designed to elongate with growth, offers potential advantages when combined with corrective osteotomy. This study retrospectively evaluated the clinical outcomes of FD nail fixation with osteotomy for long bone fractures and deformities in children with OI.
METHODS: We retrospectively revie…
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: This study seeks to examine the impact of anterior and posterior vault distraction osteogenesis (A-PVDO) in conjunction with 3D-printed positioning and shaping templates for the management of Apert syndrome.
METHODS: From January 2018 to February 2022, a retrospective analysis was conducted on 6 cases of Apert syndrome employing fronto-orbital 3D-printed positioning and molding templates. The cranium underwent surgical modification in accordance with the template's configuration and was affixed with absorbable plates. Subsequently, distraction devices were applied, encompassing bot…
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION AND IMPORTANCE: Temporomandibular joint (TMJ) ankylosis in children severely impacts mouth opening, orofacial growth, airway space, and overall quality of life. While costochondral grafts (CCG) are the gold standard for end-stage TMJ reconstruction in children, their unpredictable growth poses challenges, including potential overgrowth, undergrowth, resorption, and reankylosis. However, recent reports have suggested the feasibility of alloplastic TMJ in pediatric patients. This case represents one of the youngest patients to undergo alloplastic bilateral TMJ reconstruction for end
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
One of the most important steps in post-translational modifications of collagen type I chains is the hydroxylation of carbon-3 of proline residues by prolyl-3-hydroxylase-1 (P3H1). Genetic variants in P3H1 have been reported to cause autosomal recessive osteogenesis imperfecta (OI) type VIII. Clinical and radiographic examinations, whole-exome sequencing (WES), and bioinformatic analysis were performed in 11 Thai children of Karen descent affected by multiple bone fractures. Clinical and radiographic findings in these patients fit OI type VIII. Phenotypic variability is evident. WES identified…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: Osteogenesis imperfecta (OI) is a disease caused by defective collagen synthesis. Collagen type 1 is found in many structures in the cardiovascular system. Endothelial dysfunction, which develops prior to the emergence of structural and clinical signs of atherosclerosis, is believed to play a key role in atherogenesis. Endothelial dysfunction may be detected presymptomatically by non-invasive radiologic methods, such as flow-mediated dilatation (FMD) and carotid intima-media thickness (CIMT). These modalities may provide early indicators of endothelial dysfunction. This cross-secti…
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This study explored the role of transient receptor potential channel melastatin 2 (TRPM2)-mediated activation of NOD-, LRR-, and pyrin domain-containing protein 3 (NLRP3) inflammasome in osteogenesis during healing of tooth extraction sockets. Tooth extraction socket tissue samples were collected from patients with or without periodontitis. In a TRPM2 knockout mouse model of socket healing, mice with or without periodontitis and their wild-type littermates were used for comparing the socket healing phenotypes. Micro-computed tomography imaging, three-dimensional reconstruction of the sockets, …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bone-borne trans -sutural distraction osteogenesis (TSDO) is widely used to treat midfacial hypoplasia in children with cleft lip and palate; however, its effects on the cranial base are still poorly understood. The authors aimed to study morphological changes in the cranial base after TSDO. Pre and postoperative computed tomography (CT) images of cleft lip and palate children with midfacial skeleton dysplasia who underwent TSDO were collected retrospectively, and their corresponding 3-dimensional models were measured. Results showed no significant change in the length of the anterior or poste…
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Osteogenesis imperfecta (OI) is a heritable bone fragility disorder that is usually caused by mutations affecting collagen type I synthesis in osteoblasts. Bisphosphonates are widely used to decrease fracture rate but are only partially effective. Bone anabolic compounds, such as prostaglandin E2 receptor 4 (EP4) agonists may be an alternative treatment approach. Here we assessed the effect of Mes-1007, a novel bone-targeted EP4 agonist in Jrt mice, a model of severe OI.
STUDY DESIGN: Experimental study.
RESULTS: Male 8-week old wild type (WT) and OI mice were randomly assigned to…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Receptor tyrosine kinase-like orphan receptor 2 (Ror2) plays a key role in bone formation, but its signaling pathway is not completely understood. Signal transducer and activator of transcription 3 (Stat3) takes part in maintaining bone homeostasis. The aim of this study is to reveal the role and mechanism of Ror2 in the osteogenic differentiation from mouse bone marrow mesenchymal stem cells (mBMSCs) and to explore the effect of Stat3 on Ror2-mediated osteogenesis.
METHODS: Ror2 CKO mice were generated via the Cre-loxp recombination system using Prrx1-Cre transgenic mice. Quantit…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: The aim of this study is to evaluate the clinical outcome of flap transfer followed by delayed bone transport using external fixa … as used to reconstruct bony defects by bifocal or trifocal bone transport using delayed distraction osteogenesis. The functional results were evaluated by Association for the Study and Application of the Method of Ilizarov scoring system, and all postoperative complications were recorded.
RESULTS: The mean duration of follow-up after removal of fixator was 29 …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osteogenesis imperfecta (OI) is a genetic disorder characterized by brittle bones. OI type I is the most common and usually the mildest form. We generated human induced pluripotent stem cells (hiPSCs), KSCBi006-A, from the peripheral blood mononuclear cells of a patient with OI type I using the Sendai virus delivery method. The generated hiPSCs retained the disease-causing DNA mutation (COL1A1, c.3162delT) and showed a normal karyotype. KSCBi006-A also has pluripotency and the capacity for differentiation into the three germ layers. These patient-specific iPSCs provide a valuable cellular mode…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA2018eng
In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).
СтатьяОпубликованное исправлениеПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osteogenesis imperfecta (OI) is a rare disabling genetic connective tissue disorder. General anesthesia in these patients is associated with increased risks. Regional anesthesia is favored wherever feasible, but there are limited reports of use of a sole regional technique in OI in pediatric patients. Moreover, combined spinal-epidural anesthesia has never been described previously. We are reporting the use of combined spinal-epidural anesthesia for a prolonged surgery (multiple osteotomies) of lower limbs in a 10-year-old wheelchair-bound child with OI type III. Preoperative counseling, ultra…
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования