Уникальные публикации PubMed, Europe PMC и Crossref, сохранённые в библиотеке. Одна статья учитывается один раз, даже если получена из нескольких источников. Личные исследования и документы команд не публикуются.
Идёт проверка счётчикаДоступно в поиске—
Публикации, уже подготовленные для быстрого поиска. Остальная библиотека подключается в фоне.
Переведено на русский—
Готовые переводы среди доступных в поиске публикаций. Автоматический медицинский перевод и проверка специалистом учитываются отдельно.
Полные тексты—
Найденные полные тексты среди доступных в поиске публикаций. Доступность определяется первоисточником и условиями использования.
Оригиналов на русском—
Русскоязычные оригиналы доступны без ожидания перевода. Ниже — языки остальных оригиналов; для них готовится медицинский перевод на русский.
Пополняем библиотеку по диагнозам—Проверяем состояние обновлений
Для каждого диагноза из справочника МКБ-10 ищем связанные публикации в научных базах и добавляем их в библиотеку. Числа ниже — диагнозы, а не статьи.
Если сбор прервался, тема требует повторной попытки. Уже сохранённые статьи остаются в библиотеке.
Нажмите на показатель для подробностей. Показатели поиска обновляются автоматически; размер всей библиотеки сверяется отдельно. Время последней проверки указано явно.
Результаты поиска
7463 публикаций
Поиск: 162 мс
Публикации на разных языках · PubMed, Europe PMC и данные издателей через Crossref · 672 с найденным полным текстом
H2O and CO2 are considered as fundamental precursors for the prebiotic formation of biomolecules. Their conversion to biomolecules under early Earth conditions is critical for understanding origin of life. However, direct formation from these simple compounds remains unverified, leaving the mechanistic role of H2O unresolved. Herein, we demonstrate ribose synthesis from H2O and CO2 under prebiotic conditions via hydrodynamic cavitation, a process naturally occurring in ancient oceans. Ca2+-mediated hydrodynamic cavitation in a Venturi reactor produced ribose as the major sugar product. Ribose
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Glycation is vital in terms of its damaging effect on macromolecules resulting in the formation of end products, which are highly reactive and cross-linked irreversible structures, known as advanced glycation end products (AGEs). The continuous accumulation of AGEs is associated with severe diabetes and its associated ailments. Saccharides with their reducing ends can glycate amino acid side chains of proteins, among them glucose is well-known for its potent glycating capability. However, other reducing sugars can be more reactive glycating agents than glucose. The D-ribose is a pentose sugar-
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Disruption of cellular functions with aging-induced accumulation of neuronal stressors causes cell death which is a common feature of neurodegenerative diseases. Studies in a variety of neurodegenerative disease models demonstrate that poly (ADP-ribose) (PAR)-dependent cell death, also named parthanatos, is responsible for neuronal loss in neurological diseases, such as Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). Parthanatos has distinct features that differ from caspase-dependent apoptosis, necrosis or autophagic cell
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE OF REVIEW: Poly (ADP-ribose) polymerase inhibitors (PARPi) are approved drugs for the treatment of ovarian and breast cancer and currently under investigation for the treatment of prostate cancer and other malignancies with aberrations in homologous recombination DNA repair.This review summarizes literature published during 2017 concerning the relevance of PARPi in prostate cancer and presents new evidence on mechanisms of resistance and biomarkers of response.
RECENT FINDINGS: The approval of several PARPi (olaparib, rucaparib, and niraparib) has driven the focus of anticancer treatm
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Niraparib is an oral poly(ADP ribose) polymerase (PARP) inhibitor that is currently approved by the United States Food and Drug Administration (US FDA) as well as recently approved by the European Medicines Agency (EMA) for the maintenance treatment of women with recurrent ovarian cancer who are in complete or partial response to platinum-based chemotherapy. The mechanisms of action of niraparib include inhibition of PARP enzymatic activity as well as increased formation of PARP-DNA complexes through "trapping" the PARP enzyme on damaged DNA. Phase I and III studies have demonstrated activity
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To identify and characterize glycation, induced modifications of DNA are crucial toward understanding their functional significance due to their significant role in the long term control of aging and age-related diseases. In this study, we present the ability of Raman microspectroscopy as a novel analytical technique for a rapid and reliable identification of glycated DNA in a reagent-free manner. We have demonstrated that this technique has potential to provide very small conformational modifications. The combination of principal component analysis (PCA) and two-dimensional (2D) correlation s
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Store-operated Ca2+ entry plays an important role in Ca2+ homeostasis in cells but the mechanisms of control of these channels are not completely understood. We describe an investigation of the role of the CD38-cyclic-ADP-ribose (cADPR)-ryanodine-channel (RyR) signaling pathway in store-operated Ca2+ entry in human smooth muscle. We observed that human myometrial cells have a functional store-operated Ca2+ entry mechanism. Furthermore, we observed the presence of transient receptor potential 1, 3, 4, 5, and 6 ion channels in human myometrial cells. Store-operated Ca2+ transient was inhibited b
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ribose cysteine (RibCys) is a cysteine prodrug that increases both hepatic and renal glutathione with documented antagonism of acetaminophen (APAP)-induced hepatotoxicity. To determine if RibCys could also protect against APAP-induced kidney damage, mice were injected with APAP (600 mg/kg) or APAP and RibCys (1.0 g/kg) (APAP/RIB) followed by additional RibCys injections 1 and 2 hours later. Mice were euthanatized 10-12 hours after APAP administration, and liver and kidney toxicity were assessed by plasma sorbitol dehydrogenase (SDH) activity and blood urea nitrogen (BUN), respectively, and by
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Two hybridomas producing monoclonal antibodies to poly(adenosine diphosphate ribose) [poly(ADP-Rib)] were established. One antibody, 10H (IgG3, kappa), bound to most of the poly(ADP-Rib) preparation, which consisted of molecules of various sizes of more than 20 ADP-Rib residues. The binding of this antibody was inhibited by not only poly-(ADP-Rib) but also a monomer unit of poly(ADP-Rib), Ado(P)-Rib-P. The sites protected by antibody 10H were isolated and analyzed by hydrolysis with alkaline phosphomonoesterase and then snake venom phosphodiesterase. The sites contained the same amounts of mon
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thrombosis, a coagulation disorder, occurs due to altered levels of coagulation, fibrinolytic and immune factors, which are otherwise known to maintain hemostasis in normal physiological conditions. Here, we review the direct and indirect participation of a multifunctional nuclear enzyme poly (ADP-ribose) polymerase-1 (PARP1) in the expression of key genes and cellular processes involved in thrombotic pathogenesis. PARP1 biological activities range from maintenance of genomic integrity, chromatin remodeling, base excision DNA repair, stress responses to cell death, angiogenesis and cell cycle
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cystic fibrosis (CF) is a major lethal genetic disease caused by mutations in the CF transmembrane conductance regulator gene (CFTR). This encodes a chloride ion channel on the apical surface of epithelial cells. The most common mutation in CFTR (F508del-CFTR) generates a protein that is misfolded and retained in the endoplasmic reticulum. Identifying small molecules that correct this CFTR trafficking defect is a promising approach in CF therapy. However, to date only modest efficacy has been reported for correctors in clinical trials. We identified the marine sponge metabolite latonduine as a
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ribose-5-phosphate isomerase (RPI) belongs to the non-oxidative branch of the pentose phosphate pathway, catalysing the inter-conversion of D-ribose-5-phosphate and D-ribulose-5-phosphate. Trypanosomatids encode a type B RPI, whereas humans have a structurally unrelated type A, making RPIB worthy of exploration as a potential drug target. Null mutant generation in Leishmania infantum was only possible when an episomal copy of RPIB gene was provided, and the latter was retained both in vitro and in vivo in the absence of drug pressure. This suggests the gene is essential for parasite survival.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The present oral embryotoxicity/teratogenicity study of d-Ribose (DR) was conducted in female rats; 28 rats/group were exposed via the diet to 0, 5, 10, or 20% DR (0.0, 4.25, 7.94, 9.91g/kg body weight/day), from day 0 of gestation until Caesarian section and maternal sacrifice on day 21. All animals survived to the end of the study. Fecundity index, gestation index, pre-implantation loss, post-implantation loss, and sex ratio were all unaffected by treatment with DR. External observations of fetuses and placentas were unremarkable across the study groups. Mean fetal and placental weights, acr
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We investigated effects of poly(ADP-ribose) synthetase (PARS) inhibitors on acoustic trauma. Albino guinea pigs were intravenously given 3-aminobenzamide, nicotinamide or 3-aminobenzoic acid (an inactive analog of 3-aminobenzamide) just prior to exposure to a 2 kHz pure tone of 120 dB sound pressure level (SPL) for 10 minutes. The threshold of the compound action potential (CAP) and the amplitude of distortion-product otoacoustic emissions (DPOAEs) were measured before and 4 hours after the acoustic overexposure. Statistically significant decreases in the CAP threshold shifts and significant i
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ibuprofen, a non-steroidal drug, is well known for its anti-inflammatory activity. The effects of ibuprofen on the polarization of macrophages are still not clear. Herein, we used THP-1 monocyte-derived macrophages to find that ibuprofen has inhibitory effects on the polarization of both classically activated M1 macrophages and alternatively activated M2 macrophages by downregulating NF-κB and JAK/STAT signaling pathways. During M1 or M2 polarization, ibuprofen also downregulated the expression of poly (ADP-ribose) polymerase 1 (PARP1). Furthermore, knockdown of PARP1 by either small interferi
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECT: This study was designed to screen ideal lead compounds and drug candidates with an inhibitory effect on PARP from the drug library (ZINC database).
RESULTS: Two effective natural compounds ZINC000003938684 and ZINC000014811844 were found to bind to PARP in the ZINC database, showing a higher binding affinity. Also, they were predicted to have lower rodent carcinogenicity, Ames mutagenicity, developmental toxicity potential, and high tolerance to cytochrome P4502D6. Molecular dynamics simulation showed that ZINC000003938684 and ZINC000014811844 had a more favorable potential energies w
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: The enzyme poly(ADP-ribose) polymerase-1 (PARP-1) transfers negatively charged ADP-ribose units to target proteins. This modification can have pronounced regulatory effects on target proteins. Recent studies showed that PARP-1 can poly(ADP-ribosyl)ate (PARylate) Smad proteins. However, the role of PARP-1 in the pathogenesis of systemic sclerosis (SSc) has not been investigated.
METHODS: The expression of PARP-1 was determined by quantitative PCR and immunohistochemistry. DNA methylation was analysed by methylated DNA immunoprecipitation assays. Transforming growth factor-β (TGFβ)
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: This study tested the hypothesis that a ribose-based pre-treatment would protect the strength, ductility and toughness of γ-irradiation sterilized cortical bone.
METHODS: Experiment 1: The effects of ribose pre-treatment (1.8M in PBS at 60°C for 24h) prior to 33 kGy of irradiation on strength, ductility and toughness (beams in three-point bending) and fracture toughness (J-integral at instability in single edge notched (bending)) were tested against matched non-irradiated and irradiated controls from bovine tibiae. Experiment 2: Three-point bending tests were conducted using beams
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.