The trilaminar kinetochore directs the segregation of chromosomes in mitosis and meiosis. Despite its importance, the molecular architecture of this structure remains poorly understood [1]. The best known component of the kinetochore plates is CENP-C, a protein that is required for kinetochore assembly [2], but whose molecular role in kinetochore structure and function is unknown. Here we have raised for the first time monospecific antisera to CENP-A [3], a 17 kD centromere-specific histone variant that is 62% identical to the carboxy-terminal domain of histone H3 [4,5] and that resembles the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Small supernumerary marker chromosome (sSMC) lacking alpha satellite DNA or endogenous centromere regions are rare and contain fully functional centromeres, called neocentromeres. We report on a woman with a 14-week gestation pregnancy with a cystic hygroma and cerebellar hypoplasia at ultrasound examination. Cytogenetic studies showed a karyotype 47,XY,+mar dn. This sSMC was observed in chorionic villi, lung, and muscle tissue. Array Comparative Genomic Hybridization showed a gain from 13q31.1 to 13qter region. Fluorescent in situ hybridization with pan alpha satellite probe and probes specif
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A patient with the CREST syndrome of scleroderma was found to carry a mosaicism for a supernumerary microchromosome. The microchromosome was approximately 1 micron in size and present in over half of the lymphocyte metaphases examined. It bound centromeric proteins specifically recognized by CREST autoimmune sera (including the patient's serum). In situ hybridization with a panel of chromosome-specific alpha-satellite probes showed that the microchromosome was derived from chromosome 11, most or all of its chromatin consisting of the chromosome 11 subset of alpha-satellite DNA. It had no detec
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cytogenetic examinations were performed on 18 patients with surgically verified otosclerosis. In comparison with 15 healthy patients satellites in the somatic chromosomes of D and G groups were found to occur significantly more frequently (p less than 0.005). Moreover, among the patients a case of 45,X karyotype with clinically incomplete Turner syndrome has been disclosed. The results obtained seem to support genetic hypothesis of otospongiosis pathogenesis.
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Vanadium is considered as "possibly carcinogenic to humans" (V2O5, IARC Group 2B), yet uncertainties persist related to the toxicity mechanisms of the multiple forms of vanadium. Exposure to vanadium often co-occurs with other metals or with organic compounds that can be transformed by cytochrome p450 (CYP) enzymes into DNA-reactive carcinogens. Therefore, effects of a soluble form of vanadium (sodium metavanadate, NaVO3) and aflatoxin-B1 (AFB1) were tested separately and together, for induction of CYP activities, DNA damage (γH2AX and DNA alkaline unwinding assays), and DNA methylation change
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
While the human genome represents the most accurate vertebrate reference assembly to date, it still contains numerous gaps, including centromeric and other large repeat-containing regions - often termed the "dark side" of the genome - many of which are of fundamental biological importance. Miga et al.1,2 present the first gapless assembly of the human X chromosome, with the help of ultra-long-read nanopore reads generated for the haploid complete hydatidiform mole (CHM13) genome. They reconstruct the ~3.1 megabase centromeric satellite DNA array and map DNA methylation patterns across complex
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The simple tetranucleotide repeat GATA (GACA) occurs in all eukaryotes so far studied. In many species, the arrangement of these sequences varies considerably among individuals. Thus GATA (GACA) type probes produce DNA fingerprints when hybridized with restricted DNA from different individuals within a species. Banded krait minor (Bkm) satellite DNA (related to sequences originally recovered from the W chromosome of the banded krait and consisting essentially of a series of GATA repeats) is found in a wide spectrum of vertebrates and invertebrates. We used the Bkm 2(8) clone to evaluate the oc
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: DNA methylation and its oxidative derivatives are key components of epigenetic regulation, yet their roles in plant repetitive DNA remain poorly understood. Here, we investigate the genomic distribution of oxidized cytosine modifications: 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxycytosine (5caC) within the repeat-rich genome of Silene latifolia, a dioecious plant with heteromorphic sex chromosomes.
MATERIALS AND METHODS: Using low-coverage oxi-mC sequencing combined with RepeatExplorer2 clustering, ChIP-seq Mapper analysis, genome mapping, and immunoFIS
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Three cases of inherited satellited Y chromosomes (Yqs) were analysed using several cytogenetic techniques. The cytogenetic data of the 14 cases of Yqs chromosomes described to date were reviewed. All Yqs chromosomes carry an active nucleolus organizer region (NOR) in their long arm and must have developed from translocations involving the short arms of the acrocentric autosomes. The structure of the heterochromatic satellite region in the Yqs chromosomes shows conspicuous inter-familial differences; this permits the reconstruction of the translocations from which the various Yqs were derived.
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Centromere protein B (CENP-B) is a centromeric DNA-binding protein that binds to alpha-satellite DNA at the 17 bp CENP-B box sequence. The binding of CENP-B, along with other proteins, to alpha-satellite DNA sequences at the centromere, is thought to package the DNA into heterochromatin subjacent to the kinetochore of mitotic chromosomes. To determine the importance of CENP-B to kinetochore assembly and function, we generated a mouse null for the cenpB gene. The deletion removed part of the promoter and the entire coding sequence except for the carboxyl-terminal 35 amino acids of the CENP-B po
СтатьяПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chagas disease, caused by the Trypanosoma cruzi parasite in the Americas affects ∼ 7 million people, 30% with cardiac tissue damage and 10-15% with digestive disorders. In this study, we have developed a protocol to detect the presence of the parasite and estimate its load in resected dysfunctional tissue segments of chronically infected patients with digestive megacolon. We have included samples from 43 individuals, 38/5 with positive/negative serology for Chagas disease and digestive syndromes. Samples of 1.5 to 2.0 cm2 were taken from different points of the dysfunctional digestive tract in
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We present T2T-MMU8v2.0, a near-perfect telomere-to-telomere assembly of the rhesus macaque (Macaca mulatta), representing high base-level accuracy reported in a primate genome. Our optimized assembly strategy exposes subtelomeric satellite-rich regions as the principal bottleneck in obtaining full assemblies, owing to long-read technological biases and limitations in hybrid assembly frameworks. By resolving ∼8 Mbp of SATR satellite arrays and discovering 268 previously unannotated repeat families, we define four distinct SATR genomic architectures, each with unique satellite composition, segm
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several interphase methodologies have been applied in this study to investigate whether chemically induced undercondensation of the pericentromeric region of human fibroblast chromosomes promotes structural or numerical aberrations at the cell cycles following treatment. To achieve this aim, the effects of the hypomethylating agent 5-azacytidine (5- azaC) were studied on cytokinesis-blocked binucleated fibroblasts. This approach allowed the distribution of whole chromosomes or chromosome fragments in the daughter nuclei and micronuclei of treated cells to be followed, since the daughter nuclei
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In Japan, a fatal case due to Legionella micdadei was first recognized in our laboratory in 1986. On the epidemiological study just after the case, no Legionella was detected from the environmental samples of the patient's residence, such as shower water, tank water and so on. In the course of prospective investigations, no Legionella was isolated, but many organisms were grown on BCYE alpha and MWY agar plates. In the retrospective study, one of these organisms was found to support satellite growth of Legionella on BCYEagar without L-cysteine. This was the isolate from the shower hose and ide
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
KEY POINTS: Severe burns result in profound skeletal muscle atrophy that hampers recovery. The activity of skeletal muscle stem cells, satellite cells, acutely following a severe burn is unknown and may contribute to the recovery of lean muscle. Severe burn injury induces skeletal muscle regeneration and myonuclear apoptosis. Satellite cells undergo concurrent apoptosis and activation acutely following a burn, with a net reduction in satellite cell content compared to healthy controls. The activation and apoptosis of satellite cells probably impacts the recovery of lean tissue following a seve
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Non-coding RNA from pericentromeric satellite repeats are involved in stress-dependent splicing processes, maintenance of heterochromatin, and are required to protect genome stability. Here we show that the long non-coding satellite III RNA (SatIII) generates resistance against the topoisomerase IIa (TOP2A) inhibitor etoposide in lung cancer. Because heat shock conditions (HS) protect cells against the toxicity of etoposide, and SatIII is significantly induced under HS, we hypothesized that the protective effect could be traced back to SatIII. Using genome methylation profiles of patient-deriv
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sepsis is an acute systemic inflammatory response of the body to microbial infection and a life threatening condition associated with multiple organ failure. Survivors may display long-term disability with muscle weakness that remains poorly understood. Recent data suggest that long-term myopathy in sepsis survivors is due to failure of skeletal muscle stem cells (satellite cells) to regenerate the muscle. Satellite cells impairment in the acute phase of sepsis is linked to unusual mitochondrial dysfunctions, characterized by a dramatic reduction of the mitochondrial mass and hyperactivity of
СтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disorder that shows DNA hypomethylation at pericentromeric satellite-2 and -3 repeats in chromosomes 1, 9 and 16. ICF syndrome is classified into two groups: type 1 (ICF1) patients have mutations in the DNMT3B gene and about half of type 2 (ICF2) patients have mutations in the ZBTB24 gene. Besides satellite-2 and -3 repeats, α-satellite repeats are also hypomethylated in ICF2. In this study, we report three novel ZBTB24 mutations in ICF2. A Japanese patient was homozygous for a missense
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this study the suitability of fluorescence in situ hybridization (FISH) for dicentric detection using a commercially available alpha-satellite probe (Oncor) to label centromeres was compared with the conventional technique for the detection of unstable aberrations. A standard FISH protocol was applied for centromere labelling. Dose-response curves using blood samples irradiated in vitro with gamma-rays (60Co) at a dose-rate of 0.1 Gy/min were established using both techniques and compared. No statistical difference was observed between either method. The FISH technique thus allows a correct
Сравнительное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования